Previous Contig 005689:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006L10Sequence498005689 (5)gb:AY039944_15604551e-47Arabidopsis thaliana putative splicing factor 3a (At5g06160) mRNA, complete cds.813008908 (6)gb:AC091532_17348109e-74Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence.
JMFF015B24Sequence553005689 (5)gb:AY039944_15604552e-59Arabidopsis thaliana putative splicing factor 3a (At5g06160) mRNA, complete cds.740008908 (6)gb:AC091532_17348105e-46Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence.
JMFF031I05Sequence521005689 (5)gb:AY039944_15604552e-49Arabidopsis thaliana putative splicing factor 3a (At5g06160) mRNA, complete cds.174008908 (6)
JMSF017H24Sequence237005689 (5)gb:AY039944_15604551e-08Arabidopsis thaliana putative splicing factor 3a (At5g06160) mRNA, complete cds.777008908 (6)gb:AC091532_17348105e-62Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence.
JMSF030K14Sequence639005689 (5)gb:AY039944_15604551e-66Arabidopsis thaliana putative splicing factor 3a (At5g06160) mRNA, complete cds.725008908 (6)gb:AC091532_17348101e-65Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015B24+ CCTGACTTCAATCCTAGTGCAGCTAATGCCTCCTTCAGCTTATCAGG
                      ____________________________________________________________
consensus CCTGACTTCAATCCTAGTGCAGCTAATGCCTCCTTCAGCTTATCAGG
 
. : . : . : . : . : . :
JMFF015B24+ GCCCACTTCCATCAATTCCTCAACTGTACTATAGTAGTCAAGATCAATCACAGTATGATC
                      ____________________________________________________________
consensus GCCCACTTCCATCAATTCCTCAACTGTACTATAGTAGTCAAGATCAATCACAGTATGATC
 
. : . : . : . : . : . :
JMFF015B24+ CATTGAAGCACTCCCATTTTCCTGAGAATCATCATCCCATCCTTCAAAGCTCCCATTTGT
                      ____________________________________________________________
consensus CATTGAAGCACTCCCATTTTCCTGAGAATCATCATCCCATCCTTCAAAGCTCCCATTTGT
 
. : . : . : . : . : . :
JMFF015B24+ CCATTGCTCTTCAAACTCAGCAACCACCTTTGAAAATATCCTATCAGTGTCCTGCAAAGG
                      ____________________________________________________________
consensus CCATTGCTCTTCAAACTCAGCAACCACCTTTGAAAATATCCTATCAGTGTCCTGCAAAGG
 
. : . : . : . : . : . :
JMFF015B24+ CTCTGTCTGCTCGAAAAAATATATCAAATACTCAAGTAACTTCTGCAAATATTCCCTGTA
                      ____________________________________________________________
consensus CTCTGTCTGCTCGAAAAAATATATCAAATACTCAAGTAACTTCTGCAAATATTCCCTGTA
 
. : . : . : . : . : . :
JMFF015B24+ CTGCCTTGTTGACTTCAGTTTGCGCGAAATCTTGTGTGGTTTGTAGAAGACGTCAAGATA
JMSF030K14+ TGCGCGAAATCTTGTGTGGTTTGTAGAAGACGTCAAGATA
                      ____________________________________________________________
consensus CTGCCTTGTTGACTTCAGTTTGCGCGAAATCTTGTGTGGTTTGTAGAAGACGTCAAGATA
 
. : . : . : . : . : . :
JMFF015B24+ AGCAGTATATTCAATTGGCTCACCAAATTTGGAGTTAATATATTCACCAAACAGTTCATG
JMSF030K14+ AGCAGTATATTCAATTGGCTCACCAAATTTGGAGTTAATATATTCACCAAACAGTTCATG
                      ____________________________________________________________
consensus AGCAGTATATTCAATTGGCTCACCAAATTTGGAGTTAATATATTCACCAAACAGTTCATG
 
. : . : . : . : . : . :
JMFF015B24+ CAAATCTAGGTATCGCCCAAACCCC-TCTTCCCCACTAAACTCCATCTGTGGCTCCTCCT
JMFF031I05+ GTATCGCCCAAACCCCTTNTTCCCCACTAAACTCCATCTGTGGCTCCTCCT
JMFF006L10+ CCACTAAACTCCATCTGTGGCTCCTCCT
JMSF030K14+ CAAATCTAGGTATCGCCCAAACCCC-TCTTCCCCACTAAACTCCATCTGTGGCTCCTCCT
                      ____________________________________________________________
consensus CAAATCTAGGTATCGCCCAAACCCC-TCTTCCCCACTAAACTCCATCTGTGGCTCCTCCT
 
. : . : . : . : . : . :
JMFF015B24+ TGAGAAGCTGCTCATACTCATCACTGGTATCGACAACACGTGCAGCAGGATGCCGTCTAT
JMFF031I05+ TGAGAAGCTGCTCATACTCATCACTGGTATCGACAACACGTGCAGCAGGATGCCGTCTAT
JMFF006L10+ TGAGAAGCTGCTCATACTCATCACTGGTATCGACAACACGTGCAGCAGGATGCCGTCTAT
JMSF030K14+ TGAGAAGCTGCTCATACTCATCACTGGTATCGACAACACGTGCAGCAGGATGCCATCTAT
                      ____________________________________________________________
consensus TGAGAAGCTGCTCATACTCATCACTGGTATCGACAACACGTGCAGCAGGATGCCGTCTAT
 
. : . : . : . : . : . :
JMFF015B24+ GGTATTCCCGGATCTCCTTTAATCTGT
JMFF031I05+ GGTATTCCCGGATCTCCTTTAATCTGTCATAAAAAGCACTGAACACGTTAGTTCCAGTTG
JMFF006L10+ GGTATTCCCGGATCTCCTTTAATCTGTCATAAAAAGCACTGAACACGTTAGTTCCAGTTG
JMSF030K14+ GGTATTCCCGGATCTCCTTTAATCTGTCATAAAAAGCACTGAACACGTTAGTTCCAGTTG
                      ____________________________________________________________
consensus GGTATTCCCGGATCTCCTTTAATCTGTCATAAAAAGCACTGAACACGTTAGTTCCAGTTG
 
. : . : . : . : . : . :
JMFF031I05+ CAGTCTGGCCTCCAAGAGCTGCAATCTCATCCTTCCGTGCACCGTCTTTATCTTCGTAGA
JMFF006L10+ CAGTCTGGCCTCCAAGAGCTGCAATCTCATCCTTCCGTGCACCGTCTTTATCTTCGTAGA
JMSF030K14+ CAGTCTGGCCTCCAAGAGCTGCAATCTCATCCTTCCGTGCACCGTCTTTATCTTCGTAGA
                      ____________________________________________________________
consensus CAGTCTGGCCTCCAAGAGCTGCAATCTCATCCTTCCGTGCACCGTCTTTATCTTCGTAGA
 
. : . : . : . : . : . :
JMFF031I05+ TATCAACGATTTTGTGCGTGGTTTCGAGTATTTGCTCAATGACATTTCGAACGCGGTGGC
JMFF006L10+ TATCAACGATTTTGTGCGTGGTTTCGAGTATTTGCTCAATGACATTTCGAACGCGGTGGC
JMSF030K14+ TATCAACGATTTTGTGCGTGGTTTCGAGTATTTGCTCAATGACATTTCGAACGCGGTGGC
                      ____________________________________________________________
consensus TATCAACGATTTTGTGCGTGGTTTCGAGTATTTGCTCAATGACATTTCGAACGCGGTGGC
 
. : . : . : . : . : . :
JMFF031I05+ TCTGGTGGAGGCGGTCCTTGTTGGTAGCCGGCTCGGCCTGGAGATCCTTCACGATGAGCC
JMFF006L10+ TCTGGTGGAGGCGGTCCTTGTTGGTAGCCGGCTCGGCCTGGAGATCCTTCACGATGAGCC
JMSF030K14+ TCTGGTGGAGGCGGTCCTTGTTGGTAGCCGGCTCGGCCTGGAGATCCTTCACGATGAGCC
JMSF017H24+ GGTGGAGGCGGTCCTTGTTGGTAGCCGGCTCGGCCTGGAGATCCTTCACGATGAGCC
                      ____________________________________________________________
consensus TCTGGTGGAGGCGGTCCTTGTTGGTAGCCGGCTCGGCCTGGAGATCCTTCACGATGAGCC
 
. : . : . : . : . : . :
JMFF031I05+ GCTCGAGTCGTTCTATCTCCTCGTGCGACGCACGCGTCACCTCCAGTAGCGTCGACGACA
JMFF006L10+ GCTCGAGTCGTTCTATCTCCTCGTGCGACGCACGCGTCACCTCCAGTAGCGTCGACGACA
JMSF030K14+ GCTCGAGTCGTTCTATCTCCTCGTGCGACGCACGCGTCACCTCCAGTAGCGTCGACGACA
JMSF017H24+ GCTCGAGTCGTTCTATCTCCTCGTGCGACGCACGCGTCACCTCCAGTAGCGTCGACGACA
                      ____________________________________________________________
consensus GCTCGAGTCGTTCTATCTCCTCGTGCGACGCACGCGTCACCTCCAGTAGCGTCGACGACA
 
. : . : . : . : . : . :
JMFF031I05+ TTCTTCTCCGTCTTTGTTTGGTCTTCTATCCGGTGGGGTACGGCCGACGGCGAGACCTGG
JMFF006L10+ TTCTTCTCCGTCTTTGTTTGGTCTTCTATCCGGTGGGGTACGGCCGACGGCGAGACCTGG
JMSF030K14+ TTCTTCTCCGTCTTTGTTTGGTCTTCTATCCGGTGGGGTACGGCCGACGGCGAGACCTGG
JMSF017H24+ TTCTTCTCCGTCTTTGTTTGGTCTTCTATCCGGTGGGGTACGGCCGACGGCGAGACCTGG
                      ____________________________________________________________
consensus TTCTTCTCCGTCTTTGTTTGGTCTTCTATCCGGTGGGGTACGGCCGACGGCGAGACCTGG
 
. : . : . : . : . : . :
JMFF031I05+ CGGGACGATAGGGCTTCGAGCTATCGGTCTCCGTCTCACTCTCTTCTTCC
JMFF006L10+ CGGGACGATAGGGCTTCGAGCTATCGGTCTCCGTCTCACTCTCTTCTTCC
JMSF030K14+ CGGGACGATAGGGCTTCGAGCTATCGGTCTCCGTCTCACTCTCTTCTTCCGAAGTTCCCC
JMSF017H24+ CGGGACGATAGGGCTTCGAGCTATCGGTCTCCGTCTCACTCTCTTCTTCCGAAGTTCCCC
                      ____________________________________________________________
consensus CGGGACGATAGGGCTTCGAGCTATCGGTCTCCGTCTCACTCTCTTCTTCCGAAGTTCCCC