Previous Contig 005683:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017F23Sequence460005683 (2)pir|H84460|H844602e-52hypothetical protein At2g04740 [imported] - Arabidopsis thaliana>gb:AC006955_153735022766pir|H84460|H844604e-29hypothetical protein At2g04740 [imported] - Arabidopsis thaliana>gb:AC006955_153
JMSF017L04Sequence531005683 (2)pir|H84460|H844601e-56hypothetical protein At2g04740 [imported] - Arabidopsis thaliana>gb:AC006955_153791022781gb:AP003507_18300515e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017L04+ TGCACATAAAACACAACATCTGGTGGAAAGTGGCTGGTGCTGGTAGCTCCA
                      ____________________________________________________________
consensus TGCACATAAAACACAACATCTGGTGGAAAGTGGCTGGTGCTGGTAGCTCCA
 
. : . : . : . : . : . :
JMSF017L04+ TTAGCTGAATTACCTGGAACCAAGGAGTAAGGAGCATCGGAGTTTTGTTCAGCCGCGTAG
JMSF017F23+ CAAGGAGTAAGGAGCATCGGAGTTTTGTTCAGCCGCGTAG
                      ____________________________________________________________
consensus TTAGCTGAATTACCTGGAACCAAGGAGTAAGGAGCATCGGAGTTTTGTTCAGCCGCGTAG
 
. : . : . : . : . : . :
JMSF017L04+ CCATAAGCATTGGCGGAGCATCCCAAGAAGGTGTCCCTAAGGGCGGCCTGCAAGGGGGCG
JMSF017F23+ CCATAAGCATTGGCGGAGCATCCCAAGAAGGTGTCCCTAAGGGCGGCCTGCAAGGGGGCG
                      ____________________________________________________________
consensus CCATAAGCATTGGCGGAGCATCCCAAGAAGGTGTCCCTAAGGGCGGCCTGCAAGGGGGCG
 
. : . : . : . : . : . :
JMSF017L04+ AGAGGGGGAGGACGAGCCTCAAAGGCCTTGAGGAGCTTGCGGACCTTGAGATTGAGGGCG
JMSF017F23+ AGAGGGGGAGGACGAGCCTCAAAGGCCTTGAGGAGCTTGCGGACCTTGAGATTGAGGGCG
                      ____________________________________________________________
consensus AGAGGGGGAGGACGAGCCTCAAAGGCCTTGAGGAGCTTGCGGACCTTGAGATTGAGGGCG
 
. : . : . : . : . : . :
JMSF017L04+ GCGTAGTGGCAACGGTCGCCGTCAAAGGTGTGCTCGGAGCAAATGGCGCCGCATTCAAGG
JMSF017F23+ GCGTAGTGGCAACGGTCGCCGTCAAAGGTGTGCTCGGAGCAAATGGCGCCGCATTCAAGG
                      ____________________________________________________________
consensus GCGTAGTGGCAACGGTCGCCGTCAAAGGTGTGCTCGGAGCAAATGGCGCCGCATTCAAGG
 
. : . : . : . : . : . :
JMSF017L04+ AGCATCCGGGCGGCGTCGAGGTGACCTGCGAGACATGCGTAATAGAGCGCGACGGAGTCC
JMSF017F23+ AGCATCCGGGCGGCGTCGAGGTGACCTGCGAGACATGCGTAATAGAGCGCGACGGAGTCC
                      ____________________________________________________________
consensus AGCATCCGGGCGGCGTCGAGGTGACCTGCGAGACATGCGTAATAGAGCGCGACGGAGTCC
 
. : . : . : . : . : . :
JMSF017L04+ CAGCGGTCTCTGGCGTTAACATTGACGCCGGACTCGAGCAGGTAGCGGAGGCGGTCGACA
JMSF017F23+ CAGCGGTCTCTGGCGTTAACATTGACGCCGGACTCGAGCAGGTAGCGGAGGCGGTCGACA
                      ____________________________________________________________
consensus CAGCGGTCTCTGGCGTTAACATTGACGCCGGACTCGAGCAGGTAGCGGAGGCGGTCGACA
 
. : . : . : . : . : . :
JMSF017L04+ TCGCCGGCCCTAGAAGCCTCGAAAACGTCGCCGTATGGGACTTTCTTCAACGGAACTGAA
JMSF017F23+ TCGCCGGCCCTAGAAGCCTCGAAAACGTCGCCGTATGGGACTTTCTTCAACGGAACTGAA
                      ____________________________________________________________
consensus TCGCCGGCCCTAGAAGCCTCGAAAACGTCGCCGTATGGGACTTTCTTCAACGGAACTGAA
 
. : . : . : . : . : . :
JMSF017L04+ GACTGGAAGTCTTCCGGTTGTAGATCAATGTCGTCCAAGTCCGACATGGATTGATGCACC
JMSF017F23+ GACTGGAAGTCTTCCGGTTGTAGATCAATGTCGTCCAAGTCCGACATGGATTGATGCACC
                      ____________________________________________________________
consensus GACTGGAAGTCTTCCGGTTGTAGATCAATGTCGTCCAAGTCCGACATGGATTGATGCACC