Previous Contig 005674:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS064A09Sequence627005674 (3)
JMFS128G04Sequence626005674 (3)gb:AP005012_18472711e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P062
JMSF017E21Sequence208005674 (3)750011951 (4)gb:AP003872_18346062e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064A09+ CAAGACATTACCATCAGACACTTCTGTAGA
                      ____________________________________________________________
consensus CAAGACATTACCATCAGACACTTCTGTAGA
 
. : . : . : . : . : . :
JMFS064A09+ TGAATTGACGGTAGAACTAATCTGGAAAACTGTAAAGTAAGTCATTGTATTTCATTAACA
                      ____________________________________________________________
consensus TGAATTGACGGTAGAACTAATCTGGAAAACTGTAAAGTAAGTCATTGTATTTCATTAACA
 
. : . : . : . : . : . :
JMFS064A09+ CAATCAAGATTTGTATACTCCTTAATGAGATGTTACTAACCTCTGAAGTGGCAGGAGATT
                      ____________________________________________________________
consensus CAATCAAGATTTGTATACTCCTTAATGAGATGTTACTAACCTCTGAAGTGGCAGGAGATT
 
. : . : . : . : . : . :
JMFS064A09+ GTCTCTTTTTTGTAGTCCGCGTCCTCTGTTGTGGAACCTCCTCATTACCATCAGCAGATT
                      ____________________________________________________________
consensus GTCTCTTTTTTGTAGTCCGCGTCCTCTGTTGTGGAACCTCCTCATTACCATCAGCAGATT
 
. : . : . : . : . : . :
JMFS064A09+ CACCATTATTCTTTTTGCTTCTCAATTTTCGCTTCACTTTCCCTTTAGTTATGGATGATT
                      ____________________________________________________________
consensus CACCATTATTCTTTTTGCTTCTCAATTTTCGCTTCACTTTCCCTTTAGTTATGGATGATT
 
. : . : . : . : . : . :
JMFS064A09+ CCTTATCACTAGCAGGCAAACTTGATATTTCTAGATTCACATCCTTATTGTTAACCTCAT
                      ____________________________________________________________
consensus CCTTATCACTAGCAGGCAAACTTGATATTTCTAGATTCACATCCTTATTGTTAACCTCAT
 
. : . : . : . : . : . :
JMFS064A09+ GAGGACTATGGCCATTAACCCTGTATGATACTGCCACTTTAGGGGAATGAGAAAAGGACC
                      ____________________________________________________________
consensus GAGGACTATGGCCATTAACCCTGTATGATACTGCCACTTTAGGGGAATGAGAAAAGGACC
 
. : . : . : . : . : . :
JMFS064A09+ GGGAACCTAATCTACCCAATGAAACAGAATTGATGGAAGCTTCATTACTGGGTAAAACCA
                      ____________________________________________________________
consensus GGGAACCTAATCTACCCAATGAAACAGAATTGATGGAAGCTTCATTACTGGGTAAAACCA
 
. : . : . : . : . : . :
JMFS064A09+ TTCTAAGGTTTGGCAGGGCAGTGAAAAACAATTTTTGGTCAGACTTTATGGCAAAAGCTC
JMFS128G04+ TGAAAAACAATTTTTGGTCAGACTTTATGGCAAAAGCTC
                      ____________________________________________________________
consensus TTCTAAGGTTTGGCAGGGCAGTGAAAAACAATTTTTGGTCAGACTTTATGGCAAAAGCTC
 
. : . : . : . : . : . :
JMFS064A09+ TTCGCGGGATTGCCCTGGACACCAAACATATCCTTGCTTGCCGATGCAGTGTCTCCATTT
JMFS128G04+ TTCGCGGGATTGCCCTGGACACCAAACATATCCTTGCTTGCCGATGCAGTGTCTCCATTT
                      ____________________________________________________________
consensus TTCGCGGGATTGCCCTGGACACCAAACATATCCTTGCTTGCCGATGCAGTGTCTCCATTT
 
. : . : . : . : . : . :
JMFS064A09+ TCCTGATACTTCCAAACGCTGGACATTGTAAATGAGCTGCGGAATAATTCTGAAATG
JMFS128G04+ TCCTGATACTTCCAAACGCTGGACATTGTAAATGAGCTGCGGAATAATTCTGAAATGCCT
                      ____________________________________________________________
consensus TCCTGATACTTCCAAACGCTGGACATTGTAAATGAGCTGCGGAATAATTCTGAAATGCCT
 
. : . : . : . : . : . :
JMFS128G04+ TGTTCATAATAATGGAGAGGCAGCTACTAGTGGCGTTGGTGAATAGTTGTTGAACTAGCG
                      ____________________________________________________________
consensus TGTTCATAATAATGGAGAGGCAGCTACTAGTGGCGTTGGTGAATAGTTGTTGAACTAGCG
 
. : . : . : . : . : . :
JMFS128G04+ CCATTTGAGAGTTACAGCTTTTACTCTCAATACTTTTCAATGAAAAGAGTCCATCGCCGG
                      ____________________________________________________________
consensus CCATTTGAGAGTTACAGCTTTTACTCTCAATACTTTTCAATGAAAAGAGTCCATCGCCGG
 
. : . : . : . : . : . :
JMFS128G04+ ACTCAACATAGTCCCATGTGAGCTCAGAGCTTCTCCGGCACTATAAATGAAGCTTGCAAC
                      ____________________________________________________________
consensus ACTCAACATAGTCCCATGTGAGCTCAGAGCTTCTCCGGCACTATAAATGAAGCTTGCAAC
 
. : . : . : . : . : . :
JMFS128G04+ TAGAGACCTTAAATCCATCATCAGCTAATGTAATGCCAATATGTTTGAAAAAGCAAACAA
                      ____________________________________________________________
consensus TAGAGACCTTAAATCCATCATCAGCTAATGTAATGCCAATATGTTTGAAAAAGCAAACAA
 
. : . : . : . : . : . :
JMFS128G04+ TTGAGGCAATCAGCTCTGCTTCAGCCCTTTCTTTATTACGAGTTCTTCCAGTGAAGCAGT
                      ____________________________________________________________
consensus TTGAGGCAATCAGCTCTGCTTCAGCCCTTTCTTTATTACGAGTTCTTCCAGTGAAGCAGT
 
. : . : . : . : . : . :
JMFS128G04+ AAGTTCAGGTCTCAATGCAACTCTAACTGTTTCCTCAAATATGTTAAACATTTAACTTGA
JMSF017E21+ CCTCAAATATGTTAAACATTTAACTNGA
                      ____________________________________________________________
consensus AAGTTCAGGTCTCAATGCAACTCTAACTGTTTCCTCAAATATGTTAAACATTTAACTTGA
 
. : . : . : . : . : . :
JMFS128G04+ TTCCTTGAAGACGAGTGGACTGGACGAAGAAACGGAGGAGTTGGCGAGTTGCGGTGGCTG
JMSF017E21+ TTCCTTGAAGACGAGTGGACTGGACGAAGAAACGGAGGAGTTGGCGAGTTGCGGTGGCTG
                      ____________________________________________________________
consensus TTCCTTGAAGACGAGTGGACTGGACGAAGAAACGGAGGAGTTGGCGAGTTGCGGTGGCTG
 
. : . : . : . : . : . :
JMFS128G04+ AGTGGGTAGTGAGGTCTGAGGATGTGAGGAGAGAGGGCGTGAGGCGG
JMSF017E21+ AGTGGGTAGTGAGGTCTGAGGATGTGAGGAGAGAGGGCGTGAGGCGGTAGAGGCGAGGGA
                      ____________________________________________________________
consensus AGTGGGTAGTGAGGTCTGAGGATGTGAGGAGAGAGGGCGTGAGGCGGTAGAGGCGAGGGA
 
. : . : . : . : . : . :
JMSF017E21+ GAAAGCAGTGTAGCGTGAGTGAGAGGCGAGAGATGAGGACTGAGGAGTGGGCTATTGTCC
                      ____________________________________________________________
consensus GAAAGCAGTGTAGCGTGAGTGAGAGGCGAGAGATGAGGACTGAGGAGTGGGCTATTGTCC