Previous Contig 005673:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008K19Sequence549005673 (5)gb:AP005414_18514073e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN650008902 (5)gb:AB006697_15098425e-41Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563
JMFF014P07Sequence573005673 (5)gb:AP005414_18514077e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN653008902 (5)gb:AB006697_15098422e-39Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563
JMFF018L02Sequence580005673 (5)gb:AB006697_15098421e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563253008902 (5)gb:AB006697_15098420.019Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563
JMSF017D21Sequence261005673 (5)724008902 (5)gb:AB006697_15098425e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563
JMSF027G21Sequence653005673 (5)gb:AP005414_18514074e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN776008902 (5)gb:AB006697_15098426e-74Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAH20.>gb:AY054535_1563

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008K19+ CTATGCAATGTGATTACACTTTCATCCCATTTCCCATCGAGGATTTGCTG
JMFF018L02+ CCAAGTCTATGCAATGTGATTACACTTTCATCCCATTTCCCATCGAGGATTTGCTG
JMFF014P07+ CGAGGATTTGCTG
JMSF027G21+ TTTCCCATCGAGGATTTGCTG
                      ____________________________________________________________
consensus CCAAGTCTATGCAATGTGATTACACTTTCATCCCATTTCCCATCGAGGATTTGCTG
 
. : . : . : . : . : . :
JMFF008K19+ CATAAACAAATTTACAACTGAGGAGTGCAAATGTATCCCTGACTCCTCCTCTAGCTGTGC
JMFF018L02+ CATAAACAAATTTACAACTGAGGAGTGCAAATGTATCCCTGACTCCTCCTCTAGCTGTGC
JMFF014P07+ CATAAACAAATTTACAACTGAGGAGTGCAAATGTATCCCTGACTCCTCCTCTAGCTGTGC
JMSF027G21+ CATAAACAAATTTACAACTGAGGAGTGCAAATGTATCCCTGACTCCTCCTCTAGCTGTGC
                      ____________________________________________________________
consensus CATAAACAAATTTACAACTGAGGAGTGCAAATGTATCCCTGACTCCTCCTCTAGCTGTGC
 
. : . : . : . : . : . :
JMFF008K19+ CCCTGTTTTCTTATAACCAAGAGAATATAATGCCTCAGCTATGATTTGAACAAATTCAAC
JMFF018L02+ CCCTGTTTTCTTATAACCAAGAGAATATAATGCCTCAGCTATGATTTGAACAAATTCAAC
JMFF014P07+ CCCTGTTTTCTTATAACCAAGAGAATATAATGCCTCAGCTATGATTTGAACAAATTCAAC
JMSF027G21+ CCCTGTTTTCTTATAACCAAGAGAATATAATGCCTCAGCTATGATTTGAACAAATTCAAC
                      ____________________________________________________________
consensus CCCTGTTTTCTTATAACCAAGAGAATATAATGCCTCAGCTATGATTTGAACAAATTCAAC
 
. : . : . : . : . : . :
JMFF008K19+ TTTCTTGACAATTCCTTTCGAACCAACAACATCATTGCCCCCTTCACAAACTAAGGACCG
JMFF018L02+ TTTCTTGACAATTCCTTTCGAACCAACAACATCATTGCCCCCTTCACAAACTAAGGACCG
JMFF014P07+ TTTCTTGACAATTCCTTTCGAACCAACAACATCATTGCCCCCTTCACAAACTAAGGACCG
JMSF027G21+ TTTCTTGACAATTCCTTTCGAACCAACAACATCATTGCCCCCTTCACAAACTAAGGACCG
                      ____________________________________________________________
consensus TTTCTTGACAATTCCTTTCGAACCAACAACATCATTGCCCCCTTCACAAACTAAGGACCG
 
. : . : . : . : . : . :
JMFF008K19+ AGCCATTGAACAGTCACTCAATGAACAATTTGTGGGATCTCTAAGAGACTTTCTGTTCAA
JMFF018L02+ AGCCATTGAACAGTCACTCAATGAACAATTTGTGGGATCTCTAAGAGACTTTCTGTTCAA
JMFF014P07+ AGCCATTGAACAGTCACTCAATGAACAATTTGTGGGATCTCTAAGAGACTTTCTGTTCAA
JMSF027G21+ AGCCATTGAACAGTCACTCAATGAACAATTTGTGGGATCTCTAAGAGACTTTCTGTTCAA
                      ____________________________________________________________
consensus AGCCATTGAACAGTCACTCAATGAACAATTTGTGGGATCTCTAAGAGACTTTCTGTTCAA
 
. : . : . : . : . : . :
JMFF008K19+ GAGTTCTCCTGAAGATACCTTCACACGTTTGAATGGCGGTTCATCATCCTCTACACCTCC
JMFF018L02+ GAGTTCTCCTGAAGATACCTTCACACGTTTGAATGGCGGTTCATCATCCTCTACACCTCC
JMFF014P07+ GAGTTCTCCTGAAGATACCTTCACACGTTTGAATGGCGGTTCATCATCCTCTACACCTCC
JMSF027G21+ GAGTTCTCCTGAAGATACCTTCACACGTTTGAATGGCGGTTCATCATCCTCTACACCTCC
                      ____________________________________________________________
consensus GAGTTCTCCTGAAGATACCTTCACACGTTTGAATGGCGGTTCATCATCCTCTACACCTCC
 
. : . : . : . : . : . :
JMFF008K19+ CATGAACTGTATAAATCAGTCCATATATGACTCAAATATAAATACAGGCAAAAGATCCAA
JMFF018L02+ CATGAACTGTATAAATCAGTCCATATATGACTCAAATATAAATACAGGCAAAAGATCCAA
JMFF014P07+ CATGAACTGTATAAATCAGTCCATATATGACTCAAATATAAATACAGGCAAAAGATCCAA
JMSF027G21+ CATGAACTGTATAAATCAGTCCATATATGACTCAAATATAAATACAGGCAAAAGATCCAA
                      ____________________________________________________________
consensus CATGAACTGTATAAATCAGTCCATATATGACTCAAATATAAATACAGGCAAAAGATCCAA
 
. : . : . : . : . : . :
JMFF008K19+ ATAGTAATTCTATGCCCTCCAACAAATAAGTAGAACCTTC
JMFF018L02+ ATAGTAATTCTATGCCCTCCAACAAATAAGTAGAACCTTC
JMFF014P07+ ATAGTAATTCTATGCCCTCCAACAAATAAGTAGAACCTTC
JMSF027G21+ ATAGTAATTCTATGCCCTCCAACAAATAAGTAGAACCTTCCCAGACAGTGATTTCAAGTA
                      ____________________________________________________________
consensus ATAGTAATTCTATGCCCTCCAACAAATAAGTAGAACCTTCCCAGACAGTGATTTCAAGTA
 
. : . : . : . : . : . :
JMSF027G21+ TCCGAGCAAAGCAGATGCCAAAAATGGGGGAAATGTAAGTGAAATGAAAAGGGGAAAACT
                      ____________________________________________________________
consensus TCCGAGCAAAGCAGATGCCAAAAATGGGGGAAATGTAAGTGAAATGAAAAGGGGAAAACT
 
. : . : . : . : . : . :
JMSF027G21+ TGTGTGTGTAAGATTACACTTGATTCTGTGGGCGACTTGATTGATGCTTGGCTATCTAAA
JMSF017D21+ CACTTGATTCTGTGGGCGACTTGATTGATGCTTGGCTATCTAAA
                      ____________________________________________________________
consensus TGTGTGTGTAAGATTACACTTGATTCTGTGGGCGACTTGATTGATGCTTGGCTATCTAAA
 
. : . : . : . : . : . :
JMSF027G21+ TATCCGTAAATGGCATAGTCTCTAAGAAAAATGATTCTTGATAATGGCGGTAGGGTGGGG
JMSF017D21+ TATCCGTAAATGGCATAGTCTCTAAGAAAAATGATTCTTGATAATGGCGGTAGGGTGGGG
                      ____________________________________________________________
consensus TATCCGTAAATGGCATAGTCTCTAAGAAAAATGATTCTTGATAATGGCGGTAGGGTGGGG
 
. : . : . : . : . : . :
JMSF027G21+ CAAGGGATTTGGAAAGAAGATGGAAGAAAGT
JMSF017D21+ CAAGGGATTTGGAAAGAAGATGGAAGAAAGTGAACCGTGGATTACAATTTTCTATTCATC
                      ____________________________________________________________
consensus CAAGGGATTTGGAAAGAAGATGGAAGAAAGTGAACCGTGGATTACAATTTTCTATTCATC