Previous Contig 005669:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017D07Sequence466005669 (2)pir|D84536|D845361e-05hypothetical protein At2g16070 [imported] - Arabidopsis thaliana>gb:AC007134_153810013240 (2)pir|D84536|D845361e-31hypothetical protein At2g16070 [imported] - Arabidopsis thaliana>gb:AC007134_153
JMSF039L17Sequence465005669 (2)pir|D84536|D845361e-05hypothetical protein At2g16070 [imported] - Arabidopsis thaliana>gb:AC007134_153902013240 (2)pir|D84536|D845362e-31hypothetical protein At2g16070 [imported] - Arabidopsis thaliana>gb:AC007134_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039L17+ CNAATTTTGNAGNAAAAAAAAAAATACACTAGCAGGTAAACCTAAGACCAGCAGA
JMSF017D07+ AAAAAAAAAAATACACTAGCAGGTAAACCTAAGACCAGCAGA
                      ____________________________________________________________
consensus CNAATTTTGNAGNAAAAAAAAAAATACACTAGCAGGTAAACCTAAGACCAGCAGA
 
. : . : . : . : . : . :
JMSF039L17+ AATCCAAAAACAAAATGCTCGAAATTTTAATTGAGCAAAAATAGCAGAAATAAAAACTAT
JMSF017D07+ AATCCAAAAACAAAATGCTCGAAATTTTAATTGAGCAAAAATAGCAGAAATAAAAACTAT
                      ____________________________________________________________
consensus AATCCAAAAACAAAATGCTCGAAATTTTAATTGAGCAAAAATAGCAGAAATAAAAACTAT
 
. : . : . : . : . : . :
JMSF039L17+ AAGAAAACCAGGAAAAGACCTGCAAAGACGAGACTTGGAGTTCGAGTTTTTCAAGAGCTT
JMSF017D07+ AAGAAAACCAGGAAAAGACCTGCAAAGACGAGACTTGGAGTTCGAGTTTTTCAAGAGCTT
                      ____________________________________________________________
consensus AAGAAAACCAGGAAAAGACCTGCAAAGACGAGACTTGGAGTTCGAGTTTTTCAAGAGCTT
 
. : . : . : . : . : . :
JMSF039L17+ CTCGGATGTTCAAAAGGCAATCCGTTGCTTCATCGGAATCGAGCTCTGCCTCCTGGTCTA
JMSF017D07+ CTCGGATGTTCAAAAGGCAATCCGTTGCTTCATCGGAATCGAGCTCTGCCTCCTGGTCTA
                      ____________________________________________________________
consensus CTCGGATGTTCAAAAGGCAATCCGTTGCTTCATCGGAATCGAGCTCTGCCTCCTGGTCTA
 
. : . : . : . : . : . :
JMSF039L17+ CATCGGAGCTTTCTTTCCCCAATTCTTTCCCTTCCAATCTACCTGTGGCAATGCAATTAG
JMSF017D07+ CATCGGAGCTTTCTTTCCCCAATTCTTTCCCTTCCAATCTACCTGTGGCAATGCAATTAG
                      ____________________________________________________________
consensus CATCGGAGCTTTCTTTCCCCAATTCTTTCCCTTCCAATCTACCTGTGGCAATGCAATTAG
 
. : . : . : . : . : . :
JMSF039L17+ TGATCTTGGACCTCAACTCTGATATTCTAGCCAACACCAGCTCTATTCTATCTTCATCCA
JMSF017D07+ TGATCTTGGACCTCAACTCTGATATTCTAGCCAACACCAGCTCTATTCTATCTTCATCCA
                      ____________________________________________________________
consensus TGATCTTGGACCTCAACTCTGATATTCTAGCCAACACCAGCTCTATTCTATCTTCATCCA
 
. : . : . : . : . : . :
JMSF039L17+ TCTCTCTGGACTTCGGAGCTTGCTTTCAAGTGTGTTATCTGTGTAGGCGGCGTTTGGAGG
JMSF017D07+ TCTCTCTGGACTTCGGAGCTTGCTTTCAAGTGTGTTATCTGTGTAGGCGGCGTTTGGAGG
                      ____________________________________________________________
consensus TCTCTCTGGACTTCGGAGCTTGCTTTCAAGTGTGTTATCTGTGTAGGCGGCGTTTGGAGG
 
. : . : . : . : . : . :
JMSF039L17+ TAGAGAAGAGAAGGGGCTAAGAATAGGCGCTAAAAAAGATGCCCCTTT
JMSF017D07+ TAGAGAAGAGAAGGGGCTAAGAATAGGCGCTAAAAAAGATGCCCCTTTTGGAGAGTGATT
                      ____________________________________________________________
consensus TAGAGAAGAGAAGGGGCTAAGAATAGGCGCTAAAAAAGATGCCCCTTTTGGAGAGTGATT