Previous Contig 005667:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017C23Sequence228005667 (2)802011944 (2)gb:ATAC015985_15435775e-64Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc
JMSF024E08Sequence664005667 (2)gb:AP004048_18369102e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12794011944 (2)gb:ATAC015985_15435776e-64Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024E08+ CTTCTGCACAA
                      ____________________________________________________________
consensus CTTCTGCACAA
 
. : . : . : . : . : . :
JMSF024E08+ TATCCAATTAATTTGACAAGGTTCTCGTGTTCAGCCACACCAAGTACATTCACTTCTGAC
                      ____________________________________________________________
consensus TATCCAATTAATTTGACAAGGTTCTCGTGTTCAGCCACACCAAGTACATTCACTTCTGAC
 
. : . : . : . : . : . :
JMSF024E08+ ATCCATTCTTTGTGCCCCTGTATTCCTCTTCTGCTAAGTTGTTTTATGGCCACATCAACC
                      ____________________________________________________________
consensus ATCCATTCTTTGTGCCCCTGTATTCCTCTTCTGCTAAGTTGTTTTATGGCCACATCAACC
 
. : . : . : . : . : . :
JMSF024E08+ CTTTTAGTGGGATCTTCAGAATTCTTAATTGTTCCCTTATACACCGGTCCAAATCCTCCC
                      ____________________________________________________________
consensus CTTTTAGTGGGATCTTCAGAATTCTTAATTGTTCCCTTATACACCGGTCCAAATCCTCCC
 
. : . : . : . : . : . :
JMSF024E08+ TCCCCGATCTTGGTTGAGTGGTTAAAATTTTTCGTTGCAGTTTTGAGTTCTGAGAATGCA
                      ____________________________________________________________
consensus TCCCCGATCTTGGTTGAGTGGTTAAAATTTTTCGTTGCAGTTTTGAGTTCTGAGAATGCA
 
. : . : . : . : . : . :
JMSF024E08+ AAGACCCTGAGATTAGAAGGCCTCTCAGACAAATTCGGGAACTGCGTTCTTCCTCTGGAC
                      ____________________________________________________________
consensus AAGACCCTGAGATTAGAAGGCCTCTCAGACAAATTCGGGAACTGCGTTCTTCCTCTGGAC
 
. : . : . : . : . : . :
JMSF024E08+ TCCGTACTAGCATCTGATGCAGTCTTAGAATTATACTCAAGACTGGACGGCCGCAGTTCA
                      ____________________________________________________________
consensus TCCGTACTAGCATCTGATGCAGTCTTAGAATTATACTCAAGACTGGACGGCCGCAGTTCA
 
. : . : . : . : . : . :
JMSF024E08+ GGATCAGAAGAGCCAGATAAGGAGGAGAGGGCCGAATTTGAGTTCACTGTATTCAGTTCT
                      ____________________________________________________________
consensus GGATCAGAAGAGCCAGATAAGGAGGAGAGGGCCGAATTTGAGTTCACTGTATTCAGTTCT
 
. : . : . : . : . : . :
JMSF024E08+ TCTTCCTTCTTTTGAGCATTGAAGAATAGGGCGAAACACTTCATGGTCTTCAAATTAAAG
JMSF017C23+ TGAGCATTGAAGAATAGGGCGAAACACTTCATGGTCTTCAAATTAAAG
                      ____________________________________________________________
consensus TCTTCCTTCTTTTGAGCATTGAAGAATAGGGCGAAACACTTCATGGTCTTCAAATTAAAG
 
. : . : . : . : . : . :
JMSF024E08+ AAGTACAATACCCTCAGCTCGCTGCAGAATGCAGATTCTCTGGGGCAGCCTGAATTCACA
JMSF017C23+ AAGTACAATACCCTCAGCTCGCTGCAGAATGCAGATTCTCTGGGGCAGCCTGAATTCACA
                      ____________________________________________________________
consensus AAGTACAATACCCTCAGCTCGCTGCAGAATGCAGATTCTCTGGGGCAGCCTGAATTCACA
 
. : . : . : . : . : . :
JMSF024E08+ ACAATGTCACTAAAGATTCAATCTTTGACAAAAACCCAGAAGACCAAGAACTCCCACAAG
JMSF017C23+ ACAATGTCACTAAAGATTCAATCTTTGACAAAAACCCAGAAGACCAAGAACTCCCACAAG
                      ____________________________________________________________
consensus ACAATGTCACTAAAGATTCAATCTTTGACAAAAACCCAGAAGACCAAGAACTCCCACAAG
 
. : . : . : . : . : . :
JMSF024E08+ CAGCCAGACCGGCAAAAGAAGAAGAAAACGTTGGATGACCAAAAGAGGCCC
JMSF017C23+ CAGCCAGACCGGCAAAAGAAGAAGAAAACGTTGGATGACCAAAAGAGGCCCGGAGTCTTC
                      ____________________________________________________________
consensus CAGCCAGACCGGCAAAAGAAGAAGAAAACGTTGGATGACCAAAAGAGGCCCGGAGTCTTC