Previous Contig 005666:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017C13Sequence361005666 (7)751005666 (7)gb:AY084729_15698152e-77Arabidopsis thaliana clone 116131 mRNA, complete sequence.
JMSF040I07Sequence532005666 (7)gb:AY084729_15698152e-23Arabidopsis thaliana clone 116131 mRNA, complete sequence.
JMSF040J07Sequence662005666 (7)gb:AY084729_15698151e-43Arabidopsis thaliana clone 116131 mRNA, complete sequence.838005666 (7)gb:AY084729_15698151e-78Arabidopsis thaliana clone 116131 mRNA, complete sequence.
JMSF043E17Sequence809005666 (7)gb:AY084729_15698154e-59Arabidopsis thaliana clone 116131 mRNA, complete sequence.756005666 (7)gb:AY084729_15698157e-78Arabidopsis thaliana clone 116131 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017C13- ATTCTTGGTCTAAAAGAGAAACTTG
rJMSF043E17- TATTCTTGGTCTAAAAGAGAAACTTG
                      ____________________________________________________________
consensus TATTCTTGGTCTAAAAGAGAAACTTG
 
. : . : . : . : . : . :
rJMSF017C13- AAGCAATATAATGTATTTTGACTACACAATGCTACAAAATTACTCAACAAAGCTGGAACC
rJMSF043E17- AAGCAATATAATGTATTTTGACTACACAATGCTACAAAATTACTCAACAAAGCTGGAACC
rJMSF040J07- ATGTATTTTGACTACACAATGCTACAAAATTACTCAACAAAGCTGGAACC
                      ____________________________________________________________
consensus AAGCAATATAATGTATTTTGACTACACAATGCTACAAAATTACTCAACAAAGCTGGAACC
 
. : . : . : . : . : . :
rJMSF017C13- CAAAAAAGGCTACTCTGCAACTTAACACAGCATTCACTTGAGCACTACTTCCAATCCATT
rJMSF043E17- CAAAAAAGGCTACTCTGCAACTTAACACAGCATTCACTTGAGCACTACTTCCAATCCATT
rJMSF040J07- CAAAAAAGGCTACTCTGCAACTTAACACAGCATTCACTTGAGCACTACTTCCAATCCATT
                      ____________________________________________________________
consensus CAAAAAAGGCTACTCTGCAACTTAACACAGCATTCACTTGAGCACTACTTCCAATCCATT
 
. : . : . : . : . : . :
rJMSF017C13- GGCAACTGATGCTTTCAAGGAAGGAGAAACTGGATTGCGTCCAAGAAATACATCAAACAG
rJMSF043E17- GGCAACTGATGCTTTCAAGGAAGGAGAAACTGGATTGCGTCCAAGAAATACATCAAACAG
rJMSF040J07- GGCAACTGATGCTTTCAAGGAAGGAGAAACTGGATTGCGTCCAAGAAATACATCAAACAG
                      ____________________________________________________________
consensus GGCAACTGATGCTTTCAAGGAAGGAGAAACTGGATTGCGTCCAAGAAATACATCAAACAG
 
. : . : . : . : . : . :
rJMSF017C13- AGCTGAAGTAACGTTTGCCGATTCAATCTTAGCATCAATTGAGGAAGGCGTTGCATCAGA
rJMSF043E17- AGCTGAAGTAACGTTTGCCGATTCAATCTTAGCATCAATTGAGGAAGGCGTTGCATCAGA
rJMSF040J07- AGCTGAAGTAACGTTTGCCGATTCAATCTTAGCATCAATTGAGGAAGGCGTTGCATCAGA
                      ____________________________________________________________
consensus AGCTGAAGTAACGTTTGCCGATTCAATCTTAGCATCAATTGAGGAAGGCGTTGCATCAGA
 
. : . : . : . : . : . :
rJMSF017C13- TGATACACAAACAAGCATTTTGGTTGGGTCAACCCAAGTTAACACTATGAAAGTTCCTTT
rJMSF043E17- TGATACACAAACAAGCATTTTGGTTGGGTCAACCCAAGTTAACACTATGAAAGTTCCTTT
rJMSF040J07- TGATACACAAACAAGCATTTTGGTTGGGTCAACCCAAGTTAACACTATGAAAGTTCCTTT
JMSF043E17+ ACCCAAGTTAACACTATGAAAGTTCCTTT
                      ____________________________________________________________
consensus TGATACACAAACAAGCATTTTGGTTGGGTCAACCCAAGTTAACACTATGAAAGTTCCTTT
 
. : . : . : . : . : . :
rJMSF017C13- CTTAAGAGGTCTCCCTTGAAAGATGGTACGGAATGTGGAAAGGGCAGTTTCATCATCTGC
rJMSF043E17- CTTAAGAGGTCTCCCTTGAAAGATGGTACGGAATGTGGAAAGGGCAGTTTCATCATCTGC
rJMSF040J07- CTTAAGAGGTCTCCCTTGAAAGATGGTACGGAATGTGGAAAGGGCAGTTTCATCATCTGC
JMSF043E17+ CTTAAGAGGTCTCCCTTGAAAGATGGTACGGAATGTGGAAAGGGCAGTTTCATCATCTGC
                      ____________________________________________________________
consensus CTTAAGAGGTCTCCCTTGAAAGATGGTACGGAATGTGGAAAGGGCAGTTTCATCATCTGC
 
. : . : . : . : . : . :
rJMSF017C13- AGAGGGCGATTTGATTCTTGGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
rJMSF043E17- AGAGGGCGATTTGATTCTTGGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
rJMSF040J07- AGAGGGCGATTTGATTCTTGGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
JMSF040J07+ GGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
JMSF043E17+ AGAGGGCGATTTGATTCTTGGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
                      ____________________________________________________________
consensus AGAGGGCGATTTGATTCTTGGAGAGATAGCTTCATCTAACGCATCCCAGAAAGTTTTACC
 
. : . : . : . : . : . :
rJMSF017C13- ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
rJMSF043E17- ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
rJMSF040J07- ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
JMSF040J07+ ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
JMSF043E17+ ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
                      ____________________________________________________________
consensus ATCAACATCTCTCACTAAAACGATGCTTAGAGATTTCTCCAGAGGAGCTTTAAATATGGT
 
. : . : . : . : . : . :
rJMSF017C13- CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
rJMSF043E17- CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
rJMSF040J07- CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
JMSF040J07+ CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
JMSF040I07+ CTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
JMSF043E17+ CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
                      ____________________________________________________________
consensus CTCAAACAACGGGGAATCATTTTGTAGCTCAGCTGCTGAGCGTCCTCTCCAGGCATCTAA
 
. : . : . : . : . : . :
rJMSF017C13- CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
rJMSF043E17- CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
rJMSF040J07- CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
JMSF040J07+ CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
JMSF040I07+ CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
JMSF043E17+ CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
                      ____________________________________________________________
consensus CTTATTGAGGATGGATTCATTGACATATAGTCCCGCAGCATAGACCTTAACACCTATTAT
 
. : . : . : . : . : . :
rJMSF017C13- TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
rJMSF043E17- TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
rJMSF040J07- TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
JMSF040J07+ TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
JMSF040I07+ TGCAAAAACTTTTTCCCNGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
JMSF043E17+ TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
                      ____________________________________________________________
consensus TGCAAAAACTTTTTCCCTGTATCCAGTCCCAAGCAAAGATAAAGATGTGCAGCAACCGGG
 
. : . : . : . : . : . :
rJMSF017C13- GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
rJMSF043E17- GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
rJMSF040J07- GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
JMSF040J07+ GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
JMSF040I07+ GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
JMSF043E17+ GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
JMSF017C13+ T
                      ____________________________________________________________
consensus GAGGCTCAATGATCTTTGGAACTTTACATTGGTTGTTGGTTCCTCTACATACTCTGCATT
 
. : . : . : . : . : . :
rJMSF017C13- TCC
rJMSF043E17- TCCNACAGAA
rJMSF040J07- TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
JMSF040J07+ TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
JMSF040I07+ TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
JMSF043E17+ TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
JMSF017C13+ TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
                      ____________________________________________________________
consensus TCCAACAGAAGAAGATGAAGCAGCTCTGGGCGAGAATAGACCGGGAAGCCTAGCATCCAA
 
. : . : . : . : . : . :
rJMSF040J07- CGACCCTAATGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
JMSF040J07+ CGACCCTAATGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
JMSF040I07+ CGACCCTANTGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
JMSF043E17+ CGACCCTAATGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
JMSF017C13+ CGACCCTAATGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
                      ____________________________________________________________
consensus CGACCCTAATGAGAAATGAGAAGGAAATGTGGAAAAGATAGTGAAATAACTGTGGGTTTT
 
. : . : . : . : . : . :
rJMSF040J07- GCTGAGAG
JMSF040J07+ GCTGAGAGGAAGAGAAAATCTGGGTTTGACATTGCAAGAAGTGATCTTTGATTTTGTAGG
JMSF040I07+ GNTGAGAGGAAGAGAAANTCTGGGTTTGACATNGCAAGAAGTGATCTNTGATTTNGTAGG
JMSF043E17+ GCTGAGAGGAAGAGAAAATCTGGGTTTGACATTGCAAGAAGTGATCTTTGATTTTGTAGG
JMSF017C13+ GCTGAGAGGAAGAGAAAATCTGGGTTTGACATTGCAAGAAGTGATCTTTGATTTTGTAGG
                      ____________________________________________________________
consensus GCTGAGAGGAAGAGAAAATCTGGGTTTGACATTGCAAGAAGTGATCTTTGATTTTGTAGG
 
. : . : . : . : . : . :
JMSF040J07+ TGCTGAAACCGAAATCCACAGTGACGAAGGCATTGACCCAACTGCAGCCATGTTCTTGTT
JMSF040I07+ TGCTGAAACCGAAATCCACAGTGACGAAGGCATTGACCCAACTGCAGCCATGTTCTTGTT
JMSF043E17+ TGCTGAAACCGAAATCCACAGTGACGAAGGCATTGACCCAACTGCAGCCATGTTCTTGTT
JMSF017C13+ TGCTGAAACCGGAATCCACAGTGACGAAGGCATTGACCCAACTGCAGCCATGTCCTTGTT
                      ____________________________________________________________
consensus TGCTGAAACCGAAATCCACAGTGACGAAGGCATTGACCCAACTGCAGCCATGTTCTTGTT
 
. : . : . : . : . : . :
JMSF040J07+ CTCAAGTGAGGAGGGTAACAGAAAGGCGAATTCCCCTAGGCCTAGTAGTATTAAGTACGG
JMSF040I07+ CTCAAGTGAGGAGGGTAACAGAAAGGCGAATTCCCCTAGGCCTAGTAGTATTAAGTACGG
JMSF043E17+ CTCAAGTGAGGAGGGTAACAGAAAGGCGAATTCCCCTAGGCCTAGTAGTATTAAGTACGG
JMSF017C13+ CTCAAGTGAGGAGGGTAACAGAAAGGCGAATTCCCCTAGGCCTAGTAGTATTAAGTACGG
                      ____________________________________________________________
consensus CTCAAGTGAGGAGGGTAACAGAAAGGCGAATTCCCCTAGGCCTAGTAGTATTAAGTACGG
 
. : . : . : . : . : . :
JMSF040J07+ AGTATCATTTTTCCTTCC
JMSF040I07+ AGTATCATTTTTCCTTCC
JMSF043E17+ AGTATCATTTTTCCTTCCATTTTCCTCTAATTTTTTTCCTTGGCCCTTTATCTCTGAATC
JMSF017C13+ AGTATCATTTTTCCTTCCATTTTCCTCTAATTTTTTTCCTTGGCCCTTTATCTCTGAATC
                      ____________________________________________________________
consensus AGTATCATTTTTCCTTCCATTTTCCTCTAATTTTTTTCCTTGGCCCTTTATCTCTGAATC