Previous Contig 005655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016E16Sequence539005655 (4)gb:AY830138_16293461e-36Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.744002498 (5)gb:PMA534442_17007024e-65Plantago major macronuclear mRNA for sucrose transporter (suc3 gene).
JMFF024L17Sequence547005655 (4)gb:AY830138_16293465e-36Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.231002498 (5)
JMFF046N22Sequence475005655 (4)gb:AY830138_16293463e-37Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.395002498 (5)gb:AY830138_16293460.031Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMSF016P16Sequence460005655 (4)gb:AY830138_16293463e-18Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.781002498 (5)gb:PMA534442_17007025e-63Plantago major macronuclear mRNA for sucrose transporter (suc3 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046N22+ TGTAATCGGACCGCATAG
JMFF016E16+ TAG
JMFF024L17+ TAG
                      ____________________________________________________________
consensus TGTAATCGGACCGCATAG
 
. : . : . : . : . : . :
JMFF046N22+ CCAAATAAATGAAGAAAAAGCGTGTGGTATTCCAAGAGTCTGAATATAAGGAGTGAGGAG
JMFF016E16+ CCAAATAAATGAAGAAAAAGCGTGTGGTATTCCAAGAGTCTGAATATAAGGAGTGAGGAG
JMFF024L17+ CCAAATAAATGAAGAAAAAGCGTGTGGTATTCCAAGAGTCTGAATATAAGGAGTGAGGAG
                      ____________________________________________________________
consensus CCAAATAAATGAAGAAAAAGCGTGTGGTATTCCAAGAGTCTGAATATAAGGAGTGAGGAG
 
. : . : . : . : . : . :
JMFF046N22+ AGAGAGTTGCAATGCCCAGCCAAACTGGACGCCGGCGGCGACCGTACAACTGAGGATCAA
JMFF016E16+ AGAGAGTTGCAATGCCCAGCCAAACTGGACGCCGGCGGCGACCGTACAACTGAGGATCAA
JMFF024L17+ AGAGAGTTGCAATGCCCAGCCAAANTGGACGCCGGCGGCGACCGTACAACTGAGGATCAA
                      ____________________________________________________________
consensus AGAGAGTTGCAATGCCCAGCCAAACTGGACGCCGGCGGCGACCGTACAACTGAGGATCAA
 
. : . : . : . : . : . :
JMFF046N22+ GGTGAGCAGGCTGATCTGAACAGGCGACTGATGGTGACTAGAATCCGTGGAGTCGCCATT
JMFF016E16+ GGTGAGCAGGCTGATCTGAACAGGCGNCTGATGGTGACTAGAATCCGTGGAGTCGCCATT
JMFF024L17+ GGTGAGCAGGCTGATCTGAACAGGCGACTGATGGTGANTAGAATCCGTGGAGTCGCCATT
JMSF016P16+ CAGGCGACTGATGGTGACTAGAATCCGTGGAGTCGCCATT
                      ____________________________________________________________
consensus GGTGAGCAGGCTGATCTGAACAGGCGACTGATGGTGACTAGAATCCGTGGAGTCGCCATT
 
. : . : . : . : . : . :
JMFF046N22+ GGAAACCCTATGAGGTGAAAACGCCGAATCGGCCTGTGACCGACGCTGATGAAGCTCCTC
JMFF016E16+ GGAAACCCTATGAGGTGAAAACGCCGAATCGGCCTGTGACCGACGCTGATGAAGCTCCTC
JMFF024L17+ GGAAACCCTATGAGGTGAAAACGCCGAATCGGCCTGTGACCGACGCTGATGAAGCTCCTC
JMSF016P16+ GGAAACCCTATGAGGTGAAAACGCCGAATCGGCCTGTGACCGACGCTGATGAAGCTCCTC
                      ____________________________________________________________
consensus GGAAACCCTATGAGGTGAAAACGCCGAATCGGCCTGTGACCGACGCTGATGAAGCTCCTC
 
. : . : . : . : . : . :
JMFF046N22+ CGCCCCTGCCAACTCCACCTCCTGCTTTAAATTCAAGTACGGCACCTTGATTGACACCAC
JMFF016E16+ CGCCCCTGCCAACTCCACCTCCTGCTTTAAATTCAAGTACGGCACCTTGATTGACACCAC
JMFF024L17+ CGCCCCTGCCAACTCCACCTCCTGCTTTAAATTCAAGTACGGCACCTTGATTGACACCAC
JMSF016P16+ CGCCCCTGCCAACTCCACCTCCTGCTCTAAATTCAAGTACGGCACCTTGATTGACACCAC
                      ____________________________________________________________
consensus CGCCCCTGCCAACTCCACCTCCTGCTTTAAATTCAAGTACGGCACCTTGATTGACACCAC
 
. : . : . : . : . : . :
JMFF046N22+ CTCCATCATCTTCGCCTCCTTCCCACCTCCCCTTCCACTGATCCACTCAATTCACGCCCA
JMFF016E16+ CTCCATCATCTTCGCCTCCTTCCCACCTCCCCTTCCACTGATCCACTCAATTCACGCCCA
JMFF024L17+ CTCCATCATCTTCGCCTCCTTCCCACCTCCCCTTCCACTGATCCACTCAATTCACGCCCA
JMSF016P16+ CTCCATCATCTTCGCCTCCTTCCCACCTCCCCTTCCACTGATCCACTCAATTCACGCCCA
                      ____________________________________________________________
consensus CTCCATCATCTTCGCCTCCTTCCCACCTCCCCTTCCACTGATCCACTCAATTCACGCCCA
 
. : . : . : . : . : . :
JMFF046N22+ ATTTTTTCACATCCAAATGTCCAAAGCTCTAAATCATCTGAATGCCGACGAGTGATTTTG
JMFF016E16+ ACTTTTTCACATCCAAATGTCCAAAGCTCTAAATCATCTGAATGCCGACGAGTGATTTTG
JMFF024L17+ ATTTTTTCACATCCAAATGTCCAAAGCTCTAAATCATCTGAATGCCGACGAGTGATTTTG
JMSF016P16+ ATTTTTTCACATCCAAATGTCCAAAGCTCTAAATCATCTGAATGACGACGAGTGATTTTG
                      ____________________________________________________________
consensus ATTTTTTCACATCCAAATGTCCAAAGCTCTAAATCATCTGAATGCCGACGAGTGATTTTG
 
. : . : . : . : . : . :
JMFF046N22+ ACTCGTGCAAATCTAAATTGAATCCGATTCAAAC
JMFF016E16+ ACTCGTGCAAATCTAAATTGAATCCGATTCAAACGAATTGATTGATTATCCAAATGGGTG
JMFF024L17+ ACTCGTGCAAATCTAAATTGAATCCGATTCAAACGAATTGATTGATTATCCAAATGGGTG
JMSF016P16+ ACTCGTGCAAATCTAAATTGAATCCGATTCAAACGAATTGATTGATTATCCAAATGGGTG
                      ____________________________________________________________
consensus ACTCGTGCAAATCTAAATTGAATCCGATTCAAACGAATTGATTGATTATCCAAATGGGTG
 
. : . : . : . : . : . :
JMFF016E16+ CAATTAAGAGAGAAGAGATGAAGATTCACAGATCAAAATTTGGGCGCGCTTT
JMFF024L17+ CAATTAAGAGAGAAGAGATGAAGATTCACAGATCAAAATTTGGGCGCGCTTTTGTGTGAT
JMSF016P16+ CAATTAAGAGAGAAGAGATGAAGATTCACAGATCAAAATTTGGGCGCGCTTTTGTGTGAT
                      ____________________________________________________________
consensus CAATTAAGAGAGAAGAGATGAAGATTCACAGATCAAAATTTGGGCGCGCTTTTGTGTGAT
 
. : . : . : . : . : . :
JMFF024L17+ TC
JMSF016P16+ TCTCCCTGTCGGGTTTCTTGAGGGTATTCCTTCAGATACAGCGCATCGCCATTGACGCCA
                      ____________________________________________________________
consensus TCTCCCTGTCGGGTTTCTTGAGGGTATTCCTTCAGATACAGCGCATCGCCATTGACGCCA