Previous Contig 005652:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016O04Sequence336005652 (2)pir|H84830|H848303e-30hypothetical protein At2g40550 [imported] - Arabidopsis thaliana>gb:AC002336_153580011923 (2)pir|H84830|H848302e-27hypothetical protein At2g40550 [imported] - Arabidopsis thaliana>gb:AC002336_153
JMSF035M23Sequence618005652 (2)pir|H84830|H848302e-55hypothetical protein At2g40550 [imported] - Arabidopsis thaliana>gb:AC002336_153499011923 (2)pir|H84830|H848302e-16hypothetical protein At2g40550 [imported] - Arabidopsis thaliana>gb:AC002336_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035M23+ GANGGAGGGGAAGCATGA
                      ____________________________________________________________
consensus GANGGAGGGGAAGCATGA
 
. : . : . : . : . : . :
JMSF035M23+ GACTCATCATTGGCTTCCATATCCACGTCATTCATTATTGGATCATCCTCCCTCTGGCGC
                      ____________________________________________________________
consensus GACTCATCATTGGCTTCCATATCCACGTCATTCATTATTGGATCATCCTCCCTCTGGCGC
 
. : . : . : . : . : . :
JMSF035M23+ TTCTCCCTCTGTAAATCTGTATAATAAGTAGATTTTTTAAGGGAATCCATTACAACTTCA
                      ____________________________________________________________
consensus TTCTCCCTCTGTAAATCTGTATAATAAGTAGATTTTTTAAGGGAATCCATTACAACTTCA
 
. : . : . : . : . : . :
JMSF035M23+ GAAGAAGGCTCAGTCCATGGATTCTGCCCTGGGACAGGGACACAATACAACAAGCGACGC
                      ____________________________________________________________
consensus GAAGAAGGCTCAGTCCATGGATTCTGCCCTGGGACAGGGACACAATACAACAAGCGACGC
 
. : . : . : . : . : . :
JMSF035M23+ TCCCAAACTCGCATGTCAGGTGAATCACTCATTGGAAATTGAGAAACATCAGCAAACTTA
                      ____________________________________________________________
consensus TCCCAAACTCGCATGTCAGGTGAATCACTCATTGGAAATTGAGAAACATCAGCAAACTTA
 
. : . : . : . : . : . :
JMSF035M23+ TTAGTTCTCCAAGCTTCCCCATCCTTATATGCTCCAACATAAAATTCATTACCGAGCATG
JMSF016O04+ TTATATGCTCCAACATAAAATTCATTACCGAGCATG
                      ____________________________________________________________
consensus TTAGTTCTCCAAGCTTCCCCATCCTTATATGCTCCAACATAAAATTCATTACCGAGCATG
 
. : . : . : . : . : . :
JMSF035M23+ TCTTGGATCATTCCCCGGAATCGAACTAGAGTGCGGGGCTGAATCCACCTAATTGTAGAA
JMSF016O04+ TCTTGGATCATTCCCCGGAATCGAACTAGAGTGCGGGGCTGAATCCACCTAATTGTAGAA
                      ____________________________________________________________
consensus TCTTGGATCATTCCCCGGAATCGAACTAGAGTGCGGGGCTGAATCCACCTAATTGTAGAA
 
. : . : . : . : . : . :
JMSF035M23+ GGATTAAGCATCGGTACCTGTGAGAGACCGCCATCGTCAAAAAGGAACTGCCGGAAAAGT
JMSF016O04+ GGATTAAGCATCGGTACCTGTGAGAGACCGCCATCGTCAAAAAGGAACTGCCGGAAAAGT
                      ____________________________________________________________
consensus GGATTAAGCATCGGTACCTGTGAGAGACCGCCATCGTCAAAAAGGAACTGCCGGAAAAGT
 
. : . : . : . : . : . :
JMSF035M23+ TCAGTGGCGCCCCAATCCCGGCCGTCAAACGTGGAAGGATCAGAACCTGATGAAACGGCC
JMSF016O04+ TCAGTGGCGCCCCAATCCCGGCCGTCAAACGTGGAAGGATCAGAACCTGATGAAACGGCC
                      ____________________________________________________________
consensus TCAGTGGCGCCCCAATCCCGGCCGTCAAACGTGGAAGGATCAGAACCTGATGAAACGGCC
 
. : . : . : . : . : . :
JMSF035M23+ TTGTCGAACGTCAATCTGACGGCTCCAAGTGGATTTGCAAGGCAATCGTATGGTAGCCCC
JMSF016O04+ TTGTCGAACGTCAATCTGACGGCTCCAAGTGGATTTGCAAGGCAATCGTATGGTAGCCCC
                      ____________________________________________________________
consensus TTGTCGAACGTCAATCTGACGGCTCCAAGTGGATTTGCAAGGCAATCGTATGGTAGCCCC
 
. : . : . : . : . : . :
JMSF035M23+ ACCATTCTCTCTCTCTCTCTCTCTCTCTCTCTCACTCTCTAGGGTTGATCGAGGACGC
JMSF016O04+ ACCATTCTCTCTCTCTCTCTCTCTCTCTCTCTCACTCTCTAGGGTTGATCGAGGACGCTC
                      ____________________________________________________________
consensus ACCATTCTCTCTCTCTCTCTCTCTCTCTCTCTCACTCTCTAGGGTTGATCGAGGACGCTC