Previous Contig 005650:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN013M05Sequence552005650 (6)gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.
JMFN028B06Sequence556005650 (6)gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.
JMFS063D02Sequence461005650 (6)gb:AX406858_14679831e-28Sequence 19 from Patent WO0222821.
JMSF016N21Sequence529005650 (6)gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.544005650 (6)gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.
JMSF040C16Sequence600020052gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.545005650 (6)gb:AX406858_14679832e-28Sequence 19 from Patent WO0222821.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013M05+ CAAACAACAACAACATATATAACTACTAACTCGATCAGTACAATGCA
JMFN028B06+ ACAACAACAACATATATAACTACTAACTCGATCAGTACAATGCA
rJMSF040C16- ATGCA
rJMSF016N21- TGCA
                      ____________________________________________________________
consensus CAAACAACAACAACATATATAACTACTAACTCGATCAGTACAATGCA
 
. : . : . : . : . : . :
JMFN013M05+ ATATAATTAAGCTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
JMFN028B06+ ATATAATTAAGCTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
rJMSF040C16- ATATAATTAAGCTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
JMFS063D02+ AA
rJMSF016N21- ATATAATTAAGCTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
JMSF016N21+ CTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
                      ____________________________________________________________
consensus ATATAATTAAGCTAAGATCAAAATCCTAGCAGATCGAATTGAAGTAGTAAAAGAGAATAA
 
. : . : . : . : . : . :
JMFN013M05+ ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
JMFN028B06+ ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
rJMSF040C16- ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
JMFS063D02+ ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
rJMSF016N21- ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
JMSF016N21+ ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
                      ____________________________________________________________
consensus ATCCAAAGCTTATTAGCTTAATTATTTGGCATGAGAAATGAGAAATGAGAAAGAAAGAAA
 
. : . : . : . : . : . :
JMFN013M05+ TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
JMFN028B06+ TAGTTGGAATACATATGAAATGATATATTAGCTAGCTATGGGGCATTTTGGTTTGCCCTT
rJMSF040C16- TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
JMFS063D02+ TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
rJMSF016N21- TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
JMSF016N21+ TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
                      ____________________________________________________________
consensus TAGTTGGAATACATATGAAATGATATATTAGCTAGCTTAGGGGCATTTTGGTTTGCCCTT
 
. : . : . : . : . : . :
JMFN013M05+ GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
JMFN028B06+ GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
rJMSF040C16- GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
JMFS063D02+ GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
rJMSF016N21- GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
JMSF016N21+ GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
                      ____________________________________________________________
consensus GGAGTTCTTCAAGTCTCTGTAGCAAGGGCACTGGTGCTTGTTGCCGTAAGTCCCAGAAGG
 
. : . : . : . : . : . :
JMFN013M05+ CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
JMFN028B06+ CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
rJMSF040C16- CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
JMFS063D02+ CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
rJMSF016N21- CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
JMSF016N21+ CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
                      ____________________________________________________________
consensus CACACACTTGCATTTGGCACAGCACAGTTCGCAGTACTTTATGCACCTATCCTTCACCCC
 
. : . : . : . : . : . :
JMFN013M05+ AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
JMFN028B06+ AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
rJMSF040C16- AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
JMFS063D02+ AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
rJMSF016N21- AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
JMSF016N21+ AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
                      ____________________________________________________________
consensus AGCCTTCGCGCATCGACCGCTGCACTTCCCAGAACAATAACCTGAGGGTGCCACGGCGGA
 
. : . : . : . : . : . :
JMFN013M05+ ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
JMFN028B06+ ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
rJMSF040C16- ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
JMFS063D02+ ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
rJMSF016N21- ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
JMSF016N21+ ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
                      ____________________________________________________________
consensus ATCAAAGGCGGAGGAGGTGATGAGAAGAAGAGGCAGCAGCACTAGGAAAAAGCTGCAGGC
 
. : . : . : . : . : . :
JMFN013M05+ AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
JMFN028B06+ AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
rJMSF040C16- AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
JMFS063D02+ AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
rJMSF016N21- AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
JMSF016N21+ AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
                      ____________________________________________________________
consensus AAGTAAGCTCCTCCTTCTCATCATCATCATCTATCTTTCTTTTCCGATGATCCAAGAATA
 
. : . : . : . : . : . :
JMFN013M05+ TTGTGTAATGTATGTGTATTATATT
JMFN028B06+ TTGTGTAATGTATGTGTATTATATTGCCTGAA
rJMSF040C16- TTGTGTAATGTATGTGTATTATATTGCCTGAATATTATTATATGCTAGGTTGGGTGGGCC
JMFS063D02+ TTGTGTAATGTATGTGTATTATATTGCCTGAATATTATT
rJMSF016N21- TTGTGTAATGTATGTGTATTATATTGCCTGAATATTATTATATGCTAGGTTGGGTGGGCC
JMSF016N21+ TTGTGTAATGTATGTGTATTATATTGCCTGAATATTATTATATGCTAGGTTGGGTGGGCC
                      ____________________________________________________________
consensus TTGTGTAATGTATGTGTATTATATTGCCTGAATATTATTATATGCTAGGTTGGGTGGGCC