Previous Contig 005648:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS012E07Sequence608005648 (2)gb:AB084380_15243353e-34Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMSF016N17Sequence436005648 (2)805011896 (4)pir|E96561|E96561e-104hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS012E07+ TTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTT
                      ____________________________________________________________
consensus TTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTT
 
. : . : . : . : . : . :
JMFS012E07+ GATCTGTTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCG
                      ____________________________________________________________
consensus GATCTGTTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCG
 
. : . : . : . : . : . :
JMFS012E07+ AAGCGAACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGG
                      ____________________________________________________________
consensus AAGCGAACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGG
 
. : . : . : . : . : . :
JMFS012E07+ TGTGTACCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGA
JMSF016N17+ TCTCTTTACAGCTCGA
                      ____________________________________________________________
consensus TGTGTACCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGA
 
. : . : . : . : . : . :
JMFS012E07+ TGTCACCGCCATCATCACTTAATTACTTCCAAAATCAAACATCAACAATATTTCTTTTCA
JMSF016N17+ TGTCACCGCCATCATCACTTAATTACTTCCAAAATCAAACATCAACAATATTTCTTTTCA
                      ____________________________________________________________
consensus TGTCACCGCCATCATCACTTAATTACTTCCAAAATCAAACATCAACAATATTTCTTTTCA
 
. : . : . : . : . : . :
JMFS012E07+ TTCAACCAAAATTTGTAGCTTTAACTCACCAATTGAAACTACCTTGGTTAAGTTTCTATA
JMSF016N17+ TTCAACCAAAATTTGTAGCTTTAACTCACCAATTGAAACTACCTTGGTTAAGTTTCTATA
                      ____________________________________________________________
consensus TTCAACCAAAATTTGTAGCTTTAACTCACCAATTGAAACTACCTTGGTTAAGTTTCTATA
 
. : . : . : . : . : . :
JMFS012E07+ TTATCCCCAGAAAAACCCTAGAAAACAACAAGACACCACAACTATCTTCCTTTCCAAGGA
JMSF016N17+ TTATCCCCAGAAAAACCCTAGAAAACAACAAGACACCACAACTATCTTCCTTTCCAAGGA
                      ____________________________________________________________
consensus TTATCCCCAGAAAAACCCTAGAAAACAACAAGACACCACAACTATCTTCCTTTCCAAGGA
 
. : . : . : . : . : . :
JMFS012E07+ CTAATTTGAATAAACTATACTAAATCATATATAGATATACTACGAGTTTCAGCTTGTTTA
JMSF016N17+ CTAATTTGAATAAACTATACTAAATCATATATAGATATACTACGAGTTTCAGCTTGTTTA
                      ____________________________________________________________
consensus CTAATTTGAATAAACTATACTAAATCATATATAGATATACTACGAGTTTCAGCTTGTTTA
 
. : . : . : . : . : . :
JMFS012E07+ TTTATATACTAAAGATAAATAACCCACGTAAAACTTTTTTGTTTTTTGAATGAAGTCCCA
JMSF016N17+ TTTATATACTAAAGATAAATAACCCACGTAAAACTTTTTTGTTTTTTGAATGAAGTCCCA
                      ____________________________________________________________
consensus TTTATATACTAAAGATAAATAACCCACGTAAAACTTTTTTGTTTTTTGAATGAAGTCCCA
 
. : . : . : . : . : . :
JMFS012E07+ ACATCCATGTATAGATAAGAACACAGTTGAAGCTTGTGTGTGAAGCATGGAAACTTTCAA
JMSF016N17+ ACATCCATGTATAGATAAGAACACAGTTGAAGCTTGTGTGTGAAGCATGGAAACTTTCAA
                      ____________________________________________________________
consensus ACATCCATGTATAGATAAGAACACAGTTGAAGCTTGTGTGTGAAGCATGGAAACTTTCAA
 
. : . : . : . : . : . :
JMFS012E07+ ACACTTAAAAATCAAGAAATGTAC
JMSF016N17+ ACACTTAAAAATCAAGAAATGTACAAAAAAAGTAAAATAAACCACAGACAAAGATACACC
                      ____________________________________________________________
consensus ACACTTAAAAATCAAGAAATGTACAAAAAAAGTAAAATAAACCACAGACAAAGATACACC