Previous Contig 005645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001C15Sequence165005645 (4)725011859 (15)pir|T48021|T480213e-92ADP-ribosylation factor-like protein - Arabidopsis thaliana>gb:ATT17J13_1554740
JMSF003C10Sequence298005645 (4)726013948 (3)gb:AC006283_15339763e-64Arabidopsis thaliana chromosome 2 clone T1B3 map mi54, complete sequence.>gb:AY0
JMSF016N09Sequence466005645 (4)701013948 (3)gb:AC006283_15339765e-64Arabidopsis thaliana chromosome 2 clone T1B3 map mi54, complete sequence.>gb:AY0
JMSF051H20Sequence602005645 (4)748013948 (3)gb:AC006283_15339766e-65Arabidopsis thaliana chromosome 2 clone T1B3 map mi54, complete sequence.>gb:AY0

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051H20+ CACTGCAAATTAGACTCCGAAACTCCATCACCGGAGTCACCATTAC
                      ____________________________________________________________
consensus CACTGCAAATTAGACTCCGAAACTCCATCACCGGAGTCACCATTAC
 
. : . : . : . : . : . :
JMSF051H20+ CGACTTCGCAAATCTCATCCCCAATTCCAGAGCCCCTGCTACTGGACACACTACTCCCCC
                      ____________________________________________________________
consensus CGACTTCGCAAATCTCATCCCCAATTCCAGAGCCCCTGCTACTGGACACACTACTCCCCC
 
. : . : . : . : . : . :
JMSF051H20+ TCTCGCCCGCATAAGCACTGCTACTTGGGCTTGGCAACGCATCCGCTTCATCCACCTCCT
                      ____________________________________________________________
consensus TCTCGCCCGCATAAGCACTGCTACTTGGGCTTGGCAACGCATCCGCTTCATCCACCTCCT
 
. : . : . : . : . : . :
JMSF051H20+ CGGAATTGCTCCTCCAAATCAACGTACTGCTGCCAGCTCTGGATGAGCTGGCTTCGTCCA
JMSF016N09+ CAAATCAACGTACTGCTGCCAGCTCTGGATGAGCTGGCTTCGTCCA
                      ____________________________________________________________
consensus CGGAATTGCTCCTCCAAATCAACGTACTGCTGCCAGCTCTGGATGAGCTGGCTTCGTCCA
 
. : . : . : . : . : . :
JMSF051H20+ GAAAATTCCCAAAATTCGGCTCCTCCTCAGCACCCGGGTCTTCTGTTTCTATTTCATCAT
JMSF003C10+ CCTCAGCACCCGGGTCTTCTGTTTCTATTTCATCAT
JMSF016N09+ GAAAATTCCCAAAATTCGGCTCCTCCTCAGCACCCGGGTCTTCTGTTTCTATTTCATCAT
                      ____________________________________________________________
consensus GAAAATTCCCAAAATTCGGCTCCTCCTCAGCACCCGGGTCTTCTGTTTCTATTTCATCAT
 
. : . : . : . : . : . :
JMSF051H20+ GAAACGATCCATTTCCAAGCTCATTCAACTGCGACGTTCCAGAGGCATCAAAATCCGTCT
JMSF003C10+ GAAACGATCCATTTCCAAGCTCATTCAACTGCGACGTTCCAGAGGCATCAAAATCCGTCT
JMSF016N09+ GAAACGATCCATTTCCAAGCTCATTCAACTGCGACGTTCCAGAGGCATCAAAATCCGTCT
                      ____________________________________________________________
consensus GAAACGATCCATTTCCAAGCTCATTCAACTGCGACGTTCCAGAGGCATCAAAATCCGTCT
 
. : . : . : . : . : . :
JMSF051H20+ CTGACTCCGTTTCAGGGTAAGACATTGAAATGGAAGCTAGTTGATTCTCTATAGCATCCA
JMSF003C10+ CTGACTCCGTTTCAGGGTAAGACATTGAAATGGAAGCTAGTTGATTCTCTATAGCATCCA
JMSF016N09+ CTGACTCCGTTTCAGGGTAAGACATTGAAATGGAAGCTAGTTGATTCTCTATAGCATCCA
                      ____________________________________________________________
consensus CTGACTCCGTTTCAGGGTAAGACATTGAAATGGAAGCTAGTTGATTCTCTATAGCATCCA
 
. : . : . : . : . : . :
JMSF051H20+ GAGACTGATCGATTAGATTGGGGGAAGGGTTAGGGTTAGGGTTGGGATCAGAGTCGTTAT
JMSF003C10+ GAGACTGATCGATTAGATTGGGGGAAGGGTTAGGGTTAGGGTTGGGATCAGAGTCGTTAT
JMSF001C15+ AGGGTTAGGGTTGGGATCAGAGTCGTTAT
JMSF016N09+ GAGACTGATCGATTAGATTGGGGGAAGGGTTAGGGTTAGGGTTGGGATCAGAGTCGTTAT
                      ____________________________________________________________
consensus GAGACTGATCGATTAGATTGGGGGAAGGGTTAGGGTTAGGGTTGGGATCAGAGTCGTTAT
 
. : . : . : . : . : . :
JMSF051H20+ TTCCATCATTGTCGGATGATGCAGCAGCAGCCGCCGGCGACGAAGATGAATTCGAATCGG
JMSF003C10+ TTCCATCATTGTCGGATGATGCAGCAGCAGCCGCCGGCGACGAAGATGAATTCGAATCGG
JMSF001C15+ TTCCATCATTGTCGGATGATGCAGCAGCAGCCGCCGGCGACGAAGATGAATTCGAATCGG
JMSF016N09+ TTCCATCATTGTCGGATGATGCAGCAGCAGCCGCCGGCGACGAAGATGAATTCGAATCGG
                      ____________________________________________________________
consensus TTCCATCATTGTCGGATGATGCAGCAGCAGCCGCCGGCGACGAAGATGAATTCGAATCGG
 
. : . : . : . : . : . :
JMSF051H20+ AGAGCATTGCGAGAAGATACTATTTTATGGCTTCTTCACTCTCTCTCCTATTTTATGGCT
JMSF003C10+ AGAGCATTGCGAGAAGATAC
JMSF001C15+ AGAGCATTGCGAGAAGATACTATTTTATGGCTTCTTCACTCTCTCTCCTATTTTATGGCT
JMSF016N09+ AGAGCATTGCGAGAAGATACTATTTTATGGCTTCTTCACTCTCTCTCCTATTTTATGGCT
                      ____________________________________________________________
consensus AGAGCATTGCGAGAAGATACTATTTTATGGCTTCTTCACTCTCTCTCCTATTTTATGGCT
 
. : . : . : . : . : . :
JMSF051H20+ TCTTCACTCTCTC
JMSF001C15+ TCTTCACTCTCTC
JMSF016N09+ TCTTCACTCTCTCTCACAGTCCTCTGCTACGTTTTCAACTTTTTGAACGTGGCCAAGCTC
                      ____________________________________________________________
consensus TCTTCACTCTCTCTCACAGTCCTCTGCTACGTTTTCAACTTTTTGAACGTGGCCAAGCTC