Previous Contig 005639:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011C24Sequence551005639 (14)pir|T08404|T084045e-55cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154705005639 (14)gb:AY587773_16165006e-70Tamarix androssowii putative stress-responsive protein mRNA, complete cds.
JMFF028G18Sequence419005639 (14)pir|T08404|T084041e-36cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154107021293
JMFF032H15Sequence528005639 (14)pir|T08404|T084041e-50cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154665005639 (14)gb:AY587773_16165007e-67Tamarix androssowii putative stress-responsive protein mRNA, complete cds.
JMFF037B23Sequence541005639 (14)pir|T08404|T084041e-55cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154675005639 (14)gb:AY587773_16165005e-70Tamarix androssowii putative stress-responsive protein mRNA, complete cds.
JMFF037J23Sequence552005639 (14)pir|T08404|T084042e-54cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154702005639 (14)gb:AY587773_16165006e-70Tamarix androssowii putative stress-responsive protein mRNA, complete cds.
JMSF016M16Sequence424005639 (14)pir|T08404|T084042e-29cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154798005639 (14)pir|T08404|T084047e-71cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154
JMSF017M16Sequence243005639 (14)pir|T08404|T084042e-33cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154
JMSF040E23Sequence682005639 (14)pir|T08404|T084042e-74cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154851005639 (14)pir|T08404|T084042e-74cold acclimation protein homolog F18B3.110 - Arabidopsis thaliana>gb:ATF18B3_154

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037J23- ATAACCA
rJMFF011C24- TATAACCA
                      ____________________________________________________________
consensus TATAACCA
 
. : . : . : . : . : . :
rJMFF037J23- AGCAAACCATTCCAGATTCCAGTAGATTCAATATGACAGACAACCTAGTACTAAGACAAA
rJMFF037B23- TAGATTCAATATGACAGACAACCTAGTACTAAGACAAA
rJMFF032H15- TAGATTCAATATGACAGACAACCTAGTACTAAGACAAA
rJMFF011C24- AGCAAACCATTCCAGATTCCAGTAGATTCAATATGACAGACAACCTAGTACTAAGACAAA
rJMSF016M16- ATATGACAGACAACCTAGTACTAAGACAAA
rJMSF040E23- ATATGACAGACAACCTAGTACTAAGACAAA
                      ____________________________________________________________
consensus AGCAAACCATTCCAGATTCCAGTAGATTCAATATGACAGACAACCTAGTACTAAGACAAA
 
. : . : . : . : . : . :
rJMFF037J23- CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
rJMFF037B23- CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
rJMFF032H15- CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
rJMFF011C24- CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
rJMSF016M16- CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
rJMSF040E23- CTCACCAACTTAACAAATCATCAGACAAAGTTCCATGATGAATATTGTACACAATCCAAG
                      ____________________________________________________________
consensus CTCACCAACTTAACAAATCATCAGACAAAG-TCCATGATGAATATTGTACACAATCCAAG
 
. : . : . : . : . : . :
rJMFF037J23- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
rJMFF037B23- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
rJMFF032H15- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
rJMFF011C24- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
rJMSF016M16- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
rJMSF040E23- TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
                      ____________________________________________________________
consensus TTTTGCTTTCAACACAACCCAGAAAAACACAATTCTGGAATCCAGAAAGAGCTAATGGCA
 
. : . : . : . : . : . :
rJMFF037J23- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
rJMFF037B23- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
rJMFF032H15- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
rJMFF011C24- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
rJMSF016M16- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
rJMSF040E23- AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACACAATGAAGAACCAGAGA
JMSF040E23+ GAGATGACCACTAATTCAGTGAACACAATGAAGAACCAGAGA
                      ____________________________________________________________
consensus AACCATTGTCCAAACTCTGAGATGACCACTAATTCAGTGAACAAAATGAAGAACCAGAGA
 
. : . : . : . : . : . :
rJMFF037J23- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
rJMFF037B23- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
rJMFF032H15- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
rJMFF011C24- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
rJMSF016M16- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
rJMSF040E23- CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
JMSF040E23+ CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
                      ____________________________________________________________
consensus CCAGATTGGGTACACCAACAAGAGGATAATGCCTACTGTGTTCGATATACCATGGCTTTG
 
. : . : . : . : . : . :
rJMFF037J23- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
rJMFF037B23- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
rJMFF032H15- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
rJMFF011C24- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
rJMSF016M16- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
JMFF037B23+ GTTCTTGGAGCAGATAACAGCC
rJMSF040E23- AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
JMSF040E23+ AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
JMFF011C24+ TTGGAGCAGATAACAGCC
JMFF037J23+ TGGAGCAGATAACAGCC
                      ____________________________________________________________
consensus AGTGAAGGAATTGCGGAATCCACCAGACGCCCGGATGTGTTCTTGGAGCAGATAACAGCC
 
. : . : . : . : . : . :
rJMFF037J23- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
rJMFF037B23- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
rJMFF032H15- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
rJMFF011C24- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
rJMSF016M16- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
JMFF037B23+ GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
rJMSF040E23- GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
JMSF040E23+ GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
JMFF032H15+ TCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
JMSF017M16+ GTAAGCGAAGAAGTN
JMFF011C24+ GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
JMFF037J23+ GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
                      ____________________________________________________________
consensus GATCACGAGACATATCGCTGTCCCAACCCAGCTCTCTCTTATGGTGTAAGCGAAGAAGTT
 
. : . : . : . : . : . :
rJMFF037J23- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
rJMFF037B23- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
rJMFF032H15- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
rJMFF011C24- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
rJMSF016M16- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMFF037B23+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
rJMSF040E23- GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMSF040E23+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMFF032H15+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMFF028G18+ TCCAACCAGTCTGGGAAATG
JMSF017M16+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMFF011C24+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
JMFF037J23+ GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
                      ____________________________________________________________
consensus GGGAGAAACCACGAGAAGTAGGATTAGCGAGCCAGGCATTTCCAACCAGTCTGGGAAATG
 
. : . : . : . : . : . :
rJMFF037J23- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
rJMFF037B23- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
rJMFF032H15- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
rJMFF011C24- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
rJMSF016M16- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMFF037B23+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
rJMSF040E23- TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMSF040E23+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMFF032H15+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMFF028G18+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAANTTCTCC
JMSF017M16+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMFF011C24+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMFF037J23+ TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
JMSF016M16+ GTGGGAAGAACAGTNTNNTCANGANTGNTACGAGAGCAATCCATTTCCCAACTTCTCC
                      ____________________________________________________________
consensus TCGTGGGAAGAACAGTCTTATCACGACTGCTACGAGAGCAATCCATTTCCCAACTTCTCC
 
. : . : . : . : . : . :
rJMFF037J23- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
rJMFF037B23- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
rJMFF032H15- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
rJMFF011C24- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
rJMSF016M16- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMFF037B23+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
rJMSF040E23- CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMSF040E23+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMFF032H15+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMFF028G18+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMSF017M16+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMFF011C24+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMFF037J23+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
JMSF016M16+ CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
                      ____________________________________________________________
consensus CCTTAAAAGGTTAAATAACACATCAGGAAAACTTAAGAAGATGTAAGGGATTAGAAGCGC
 
. : . : . : . : . : . :
rJMFF037J23- GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
rJMFF037B23- GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
rJMFF032H15- GGTCAGCATGTTTGTTCTCCAGTTTGTCCGGTCCAATATGAGCAAATAAATGGCGGCAAA
rJMFF011C24- GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
rJMSF016M16- GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMFF037B23+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
rJMSF040E23- GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMSF040E23+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMFF032H15+ GGTCAGCATGTTTGTTCTCCAGTTTGTCCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMFF028G18+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMSF017M16+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATA
JMFF011C24+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMFF037J23+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
JMSF016M16+ GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
                      ____________________________________________________________
consensus GGTCAGCATGTTTGTTCTCCAGTTTGTTCGGTCCAATATGAGCAAATAAATGGCGGCAAA
 
. : . : . : . : . : . :
rJMFF037J23- GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCC
rJMFF037B23- GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGA
rJMFF032H15- GGAGGCGACCCATTTAAGAAA
rJMFF011C24- GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGA
rJMSF016M16- GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMFF037B23+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
rJMSF040E23- GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMSF040E23+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMFF032H15+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMFF028G18+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMFF011C24+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMFF037J23+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
JMSF016M16+ GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
                      ____________________________________________________________
consensus GGAGGCGACCCATTTAAGAAAAGAAGTGCCGAAGCCGAGACCGCCGAGGTTGGCGGCGTG
 
. : . : . : . : . : . :
rJMSF016M16- TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMFF037B23+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
rJMSF040E23- TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMSF040E23+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMFF032H15+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMFF028G18+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMFF011C24+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
JMFF037J23+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTCCCTG
JMSF016M16+ TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
                      ____________________________________________________________
consensus TTTAAGGAGGTTGTTGGCGGCGGCCTTGAGGTCTCTGAGGTCGGCATTGATGAGTTCCTG
 
. : . : . : . : . : . :
rJMSF016M16- GCCGGAAACTTCATCGGTCTNCATAGCCNAGT-ATCCATCCTCCTCATTT
JMFF037B23+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
rJMSF040E23- GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMSF040E23+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMFF032H15+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMFF028G18+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMFF011C24+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMFF037J23+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
JMSF016M16+ GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
                      ____________________________________________________________
consensus GCCGGAAACTTCATCGGTCTTCATAGCCAAGTAATCCATCCTCCTCATTTCCCTTCTCCC
 
. : . : . : . : . : . :
JMFF037B23+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCAC
rJMSF040E23- ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCAC
JMSF040E23+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCAC
JMFF032H15+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCACAGAGATCA
JMFF028G18+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCAC
JMFF011C24+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCACAGAGATCA
JMFF037J23+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCACAGAGATCA
JMSF016M16+ ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCACAGAGATCAATCAATACCCCTC
                      ____________________________________________________________
consensus ACAGATCTGCTTCTGATCTTCTTCTATCCACAAAACCACAGAGATCAATCAATACCCCTC