Previous Contig 005637:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030A19Sequence311005637 (5)657005637 (5)gb:AY085985_15710461e-08Arabidopsis thaliana clone 20442 mRNA, complete sequence.
JMSF013P11Sequence420005637 (5)739005637 (5)gb:AY085985_15710466e-12Arabidopsis thaliana clone 20442 mRNA, complete sequence.
JMSF016M01Sequence261005637 (5)561022737gb:AE016959_10232382e-04Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013P11- GATAAGACTTTGAAGGATTGTTGTCTTGACAACTAACTATTG
                      ____________________________________________________________
consensus GATAAGACTTTGAAGGATTGTTGTCTTGACAACTAACTATTG
 
. : . : . : . : . : . :
rJMFF030A19- CTGCNAAATATAAAGGATATTTACATTCCAGGTAGA
rJMSF013P11- AAAAGTACTTTCACTATTCAATTTCTGCAAAATATAAAGGATATTTACATTCCAGGTAGA
                      ____________________________________________________________
consensus AAAAGTACTTTCACTATTCAATTTCTGCAAAATATAAAGGATATTTACATTCCAGGTAGA
 
. : . : . : . : . : . :
rJMFF030A19- AGCAGTTTTTAAAATATTTCTCTACATATTTACATTGGGGGATCTTATGAAACACTGAGA
rJMSF013P11- AGCAGTTTTTAAAATATTTCTCTACATATTTACATTGGGGGATCTTATGAAACACTGAGA
                      ____________________________________________________________
consensus AGCAGTTTTTAAAATATTTCTCTACATATTTACATTGGGGGATCTTATGAAACACTGAGA
 
. : . : . : . : . : . :
rJMFF030A19- TAGCATAATTGGAAAATAAGGATTCACAAGACCTGATGACAGTGAAAAGTTCTTTTTTCC
rJMSF013P11- TAGCATAATTGGAAAATAAGGATTCACAAGACCTGATGACAGTGAAAAGTTCTTTTTTCC
                      ____________________________________________________________
consensus TAGCATAATTGGAAAATAAGGATTCACAAGACCTGATGACAGTGAAAAGTTCTTTTTTCC
 
. : . : . : . : . : . :
rJMFF030A19- CTTAATTTGCTTCATCCAACTTGGGTGCAGGGTGAACTGCTTTCTTGATTCTCTTGTTAT
rJMSF013P11- CTTAATTTGCTTCATCCAACTTGGGTGCAGGGTGAACTGCTTTCTTGATTCTCTTGTTAT
                      ____________________________________________________________
consensus CTTAATTTGCTTCATCCAACTTGGGTGCAGGGTGAACTGCTTTCTTGATTCTCTTGTTAT
 
. : . : . : . : . : . :
rJMFF030A19- CANTGCAGATCTGGAAACAGAGTTTGTGATTCTGGTGCCTGTGCTTCTGGGTATTTCCAA
rJMSF013P11- CAGTGCAGATCTGGAAACAGAGTTTGTGATTCTGGTGCCTGTGCTTCTGGGTATTTCCAA
                      ____________________________________________________________
consensus CAGTGCAGATCTGGAAACAGAGTTTGTGATTCTGGTGCCTGTGCTTCTGGGTATTTCCAA
 
. : . : . : . : . : . :
rJMFF030A19- TGAAAATTATGCNGAGAGTGGCAGCANCAGCTGCAGNTACCCCAAAGGAACAAATAGCTC
rJMSF013P11- TGAAAATTATGCAGAGAGTGGCAGCAGCAGCTGCAGCTACCCCAAAGGAACAAATAGCTC
                      ____________________________________________________________
consensus TGAAAATTATGCAGAGAGTGGCAGCAGCAGCTGCAGCTACCCCAAAGGAACAAATAGCTC
 
. : . : . : . : . : . :
rJMFF030A19- CAATTCCATTGAAGCTCCACCTCCATATATTGACTCCTCCATTCTGTTGAACACCACCAT
rJMSF013P11- CAATTCCATTGAAGCTCCACCTCCATATATTGACTCCTCCATTCTGTTGAACACCACCAT
                      ____________________________________________________________
consensus CAATTCCATTGAAGCTCCACCTCCATATATTGACTCCTCCATTCTGTTGAACACCACCAT
 
. : . : . : . : . : . :
rJMFF030A19- CCNTCTGATCACCTTCCATGGCCTTCCTTCTGTAAGCTTCTCCTACCTCCACCTTANGCA
rJMSF013P11- CCATCTGATCACCTTCCATGGCCTTCCTTCTGTAAGCTTCTCCTACCTCCACCTTAGGCA
JMSF013P11+ GCA
                      ____________________________________________________________
consensus CCATCTGATCACCTTCCATGGCCTTCCTTCTGTAAGCTTCTCCTACCTCCACCTTAGGCA
 
. : . : . : . : . : . :
rJMFF030A19- CAAAGGACTTGCTGTTGGATCTTGGTGACTCCATTTTCGCGGTGCCCGAAAACTCAGCCT
rJMSF013P11- CAAAGGACTTGCTGTTGGATCTTGGTGACTCCATTTTCGCGGTGCCCGAAAACTCAGCCT
JMSF013P11+ CAAAGGACTTGCTGTTGGATCTTGGTGACTCCATTTTCGCGGTGCCCGAAAACTCAGCCT
                      ____________________________________________________________
consensus CAAAGGACTTGCTGTTGGATCTTGGTGACTCCATTTTCGCGGTGCCCGAAAACTCAGCCT
 
. : . : . : . : . : . :
rJMFF030A19- CCTTCATCTTCTTGAAGAAAACCTGAGAAACTTCTTGCTCTGCCTGATCAAATACCACTG
rJMSF013P11- CCTTCATCTTCTTGAAGAAAACCTGAGAAACTTCTTGCTCTGCCTGATCAAATACCACTG
JMFF030A19+ TTCTTGAAGAAAACCTGAGAAACTTCTTGCTCTGCCTGATCAAATACCACTG
JMSF013P11+ CCTTCATCTTCTTGAAGAAAACCTGAGAAACTTCTTGCTCTGCCTGATCAAATACCACTG
                      ____________________________________________________________
consensus CCTTCATCTTCTTGAAGAAAACCTGAGAAACTTCTTGCTCTGCCTGATCAAATACCACTG
 
. : . : . : . : . : . :
rJMFF030A19- GGGACTCAACACCATGATCATCNTCAACTGGTAACAGTNCATGTTGAGATTGGGTGGACT
rJMSF013P11- GGGACTCAACACCATGATCATCATCAACTGGTAACAGTTCATGTTGAGATTGGGTGGACT
JMFF030A19+ GGGACTCAACACCATGATCATCATCAACTGGTAACAGTTCATGTTGAGATTGGGTGGACT
JMSF013P11+ GGGACTCAACACCATGATCATCATCAACTGGTAACAGTTCATGTTGAGATTGGGTGGACT
JMSF016M01+ CATGTTGAGATTGGGTGGACT
                      ____________________________________________________________
consensus GGGACTCAACACCATGATCATCATCAACTGGTAACAGTTCATGTTGAGATTGGGTGGACT
 
. : . : . : . : . : . :
rJMFF030A19- GGNTGATGNTGATGGAGTCA
rJMSF013P11- GGTTGATGTTGATGGAGTCAGTGTAACATTCTCTGGA
JMFF030A19+ GGTTGATGTTGATGGAGTCAGTGTAACATTCTCTGGAGAAGATTTTCTTGCCTCCTCCTC
JMSF013P11+ GGTTGATGTTGATGGAGTCAGTGTAACATTCTCTGGAGAAGATTTTCTTGCCTCCTCCTC
JMSF016M01+ GGTTGATGTTGATGGAGTCAGTGTAACATTCTCTGGAGAAGATTTTCTTGCCTCCTCCTC
                      ____________________________________________________________
consensus GGTTGATGTTGATGGAGTCAGTGTAACATTCTCTGGAGAAGATTTTCTTGCCTCCTCCTC
 
. : . : . : . : . : . :
JMFF030A19+ CATCAACATCATGGATTTCAAGGAATCCATAGTCTGGTAAGATTTCCCAACCTTCAAGAT
JMSF013P11+ CATCAACATCATGGATTTCAAGGAATCCATAGTCTGGTAAGATTTCCCAACCTTCAAGAT
JMSF016M01+ CATCAACATCATGGATTTCAAGGAATCCATAGTCTGGTAAGATTTCCCAACCTTCAAGAT
                      ____________________________________________________________
consensus CATCAACATCATGGATTTCAAGGAATCCATAGTCTGGTAAGATTTCCCAACCTTCAAGAT
 
. : . : . : . : . : . :
JMFF030A19+ CCATTAATGGAGAAACTGTAAAACTCTCAGCAGGCAGGGAGGCAGGGGAAATGAATCTTT
JMSF013P11+ CCATTAATGGAGAAACTGTAAAACTCTCAGCAGGCAGGGAGGCAGGGGAAATGAATCTTT
JMSF016M01+ CCATTAATGGAGAAACTGTAAAACTCTCAGCAGGCAGGGAGGCAGGGGAAATGAATCTTT
                      ____________________________________________________________
consensus CCATTAATGGAGAAACTGTAAAACTCTCAGCAGGCAGGGAGGCAGGGGAAATGAATCTTT
 
. : . : . : . : . : . :
JMFF030A19+ GGTTAGTTTGTGTTGAATT
JMSF013P11+ GGTTAGTTTGTGTTGAATTATTGGAGCTGAAGAAGGTGGTGGCTTTCAAGTTC
JMSF016M01+ GGTTAGTTTGTGTTGAATTATTGGAGCTGAAGAAGGTGGTGGCTTTCAAGTTCAATTTTC
                      ____________________________________________________________
consensus GGTTAGTTTGTGTTGAATTATTGGAGCTGAAGAAGGTGGTGGCTTTCAAGTTCAATTTTC