Previous Contig 005623:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004I24Sequence311005623 (9)gb:SSC507733_17224822e-29Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene721005623 (9)gb:SSC507733_17224826e-86Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene
JMFF021P19Sequence546005623 (9)gb:SSC507733_17224823e-65Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene
JMSF016H05Sequence535005623 (9)gb:SSC507733_17224823e-67Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene780005623 (9)gb:SSC507733_17224821e-94Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene
JMSF017H05Sequence522005623 (9)gb:SSC507733_17224824e-65Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene725005623 (9)gb:SSC507733_17224822e-87Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene
JMSF051D22Sequence669005623 (9)gb:SSC507733_17224821e-81Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene766005623 (9)gb:SSC507733_17224822e-88Solenostemon scutellarioides mRNA for hydroxyphenylpyruvate reductase (hppr gene

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051D22- AT
                      ____________________________________________________________
consensus AT
 
. : . : . : . : . : . :
rJMSF051D22- TTCAATCAGTGAAGCTACCAGCCTCTCAATGAGAGAACTTATTCATTTTACATGTTTGTC
rJMSF017H05- ATGAGAGAANTTATTCATTTTACATGTTTGTC
rJMSF016H05- CTCTCAATGAGAGAACTTATTCATTTTACATGTTTGTC
                      ____________________________________________________________
consensus TTCAATCAGTGAAGCTACCAGCCTCTCAATGAGAGAACTTATTCATTTTACATGTTTGTC
 
. : . : . : . : . : . :
rJMSF051D22- AAGTTCAGAGGCAATGTGCTCTGGTGATAGTAAAGGCAGGCCCCCAAACAATCATGGGTG
rJMSF017H05- AAGTTCAGAGGCAATGTGCTCTGGTGATAGTAAAGGCAGGCCCCCAAACAATCATGGGTG
rJMFF004I24- AGTTCAGAGGCAATGTGCTCTGGTGATAGTAAAGGCAGGCCCCCAAACAATCATGGGTG
rJMSF016H05- AAGTTCAGAGGCAATGTGCTCTGGTGATAGTAAAGGCAGGCCCCCAAACAATCATGGGTG
                      ____________________________________________________________
consensus AAGTTCAGAGGCAATGTGCTCTGGTGATAGTAAAGGCAGGCCCCCAAACAATCATGGGTG
 
. : . : . : . : . : . :
rJMSF051D22- TGTTCATAACAAATTCAGACCACTGGGGTTAATAGTGGTTTGTTAAGAAAGTGAGCTTCT
rJMSF017H05- TGTTCATAACAAATTCAGACCACTGGGGTTAATAGTGGTTTGTTAAGAAAGTGAGCTTCT
rJMFF004I24- TGTTCATAACAAATTCAGACCACTGGGGTTAATAGTGGTTTGTTAAGAAAGTGAGCTTCT
rJMSF016H05- TGTTCATAACAAATTCAGACCACTGGGGTTAATAGTGGTTTGTTAAGAAAGTGAGCTTCT
                      ____________________________________________________________
consensus TGTTCATAACAAATTCAGACCACTGGGGTTAATAGTGGTTTGTTAAGAAAGTGAGCTTCT
 
. : . : . : . : . : . :
rJMSF051D22- AAGTTTCCAATCACAAGGTCAGCCATGGCCTTGCGCGTTTCCATTGTTCCACTTCCAACA
rJMSF017H05- AAGTTTCCAATCACAAGGTCAGCCATGGCCTTGCGCGTTTCCATTGTTCCACTTCCAACA
rJMFF004I24- AAGTTTCCAATCACAAGGTCAGCCATGGCCTTGCGCGTTTCCATTGTTCCACTTCCAACA
rJMSF016H05- AAGTTTCCAATCACAAGGTCAGCCATGGCCTTGCGCGTTTCCATTGTTCCACTTCCAACA
                      ____________________________________________________________
consensus AAGTTTCCAATCACAAGGTCAGCCATGGCCTTGCGCGTTTCCATTGTTCCACTTCCAACA
 
. : . : . : . : . : . :
rJMSF051D22- TGGGGCAGCAGCACAACGTTATCAAGTCCAAAGAGCTCCTCAGGCACTTCAGGTTCATTT
rJMSF017H05- TGGGGCAGCAGCACAACGTTATCAAGTCCAAAGAGCTCCTCAGGCACTTCAGGTTCATTT
rJMFF004I24- TGGGGCAGCAGCACAACGTTATCAAGTCCAAAGAGCTCCTCAGGCACTTCAGGTTCATTT
rJMSF016H05- TGGGGCAGCAGCACAACGTTATCAAGTCCAAAGAGCTCCTCAGGCACTTCAGGTTCATTT
                      ____________________________________________________________
consensus TGGGGCAGCAGCACAACGTTATCAAGTCCAAAGAGCTCCTCAGGCACTTCAGGTTCATTT
 
. : . : . : . : . : . :
rJMSF051D22- TCAAATACGTCGAGCCCAGCACCACCCAAGCGGCCTTCAACAAGAGCAGATACCATCTCG
rJMSF017H05- TCAAATACGTCGAGCCCAGCACCACCCAAGCGGCCTTCAACAAGAGCAGATACCATCTCG
rJMFF004I24- TCAAATACGTCGAGCCCAGCACCACCCNAGNGGCCTTCAACAAGAGCAGATACCATCTCG
rJMSF016H05- TCAAATACGTCGAGCCCAGCACCACCCAAGCGGCCTTCAACAAGAGCAGATACCATCTCG
                      ____________________________________________________________
consensus TCAAATACGTCGAGCCCAGCACCACCCAAGCGGCCTTCAACAAGAGCAGATACCATCTCG
 
. : . : . : . : . : . :
rJMSF051D22- CGCTCATCAACGTGGGGACCCCTACCAATGTTGATGAGAACTCCTTGTGGACCTAGTGCG
rJMSF017H05- CGCTCATCAACGTGGGGACCCCTACCAATGTTGATGAGAACTCCTTGTGGACCTAGTGCG
rJMFF004I24- CGCTCATCAACGTGGGGACCCCTACCAATGTTGATGAGAACTCCTTGTGGACCTAGTGCG
rJMSF016H05- CGCTCATCAACGTGGGGACCCCTACCAATGTTGATGAGAACTCCTTGTGGACCTAGTGCG
                      ____________________________________________________________
consensus CGCTCATCAACGTGGGGACCCCTACCAATGTTGATGAGAACTCCTTGTGGACCTAGTGCG
 
. : . : . : . : . : . :
rJMSF051D22- TCGATGACTTCGCGGTTGACAATGTGGCGAGTCTCGGGAGTTAATGCGCACGCAACAACC
rJMSF017H05- TCGATGACTTCGCGGTTGACAATGTGGCGAGTCTCGGGAGTTAATGCGCACGCAACAACC
rJMFF004I24- TCGATGACTTCGCGGTTGACAATGTGGCGAGTCTCGGGAGTTAATGCGCACGCAACAACC
rJMSF016H05- TCGATGACTTCGCGGTTGACAATGTGGCGAGTCTCGGGAGTTAATGCGCACGCAACAACC
JMSF051D22+ CGGGAGTTAATGCGCACGCAACAACC
                      ____________________________________________________________
consensus TCGATGACTTCGCGGTTGACAATGTGGCGAGTCTCGGGAGTTAATGCGCACGCAACAACC
 
. : . : . : . : . : . :
rJMSF051D22- AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
rJMSF017H05- AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
rJMFF004I24- AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
rJMSF016H05- AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
JMSF051D22+ AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
                      ____________________________________________________________
consensus AAAATCTGACAATTGGAAGCCAACTCTACTACACTGGGGTAGTACTTATACTTGGTGTTT
 
. : . : . : . : . : . :
rJMSF051D22- GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
rJMSF017H05- GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
rJMFF004I24- GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
rJMSF016H05- GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
JMSF051D22+ GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
JMFF021P19+ CTTGGCA
                      ____________________________________________________________
consensus GGTTTCTCTGATCTGGTGTGGTAGCAGATTGGACAATCAAAAGCCTCTGCTCTCTTGGCA
 
. : . : . : . : . : . :
rJMSF051D22- ATTGCTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
rJMSF017H05- ATTGCTAAACCAATTCTT-CCNAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
rJMFF004I24- ATTGCTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
rJMSF016H05- ATTGCTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
JMSF051D22+ ATTGCTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
JMFF021P19+ ATTGCTAAACCAATTCTTCCCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
JMSF017H05+ T-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
JMSF016H05+ CTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
                      ____________________________________________________________
consensus ATTGCTAAACCAATTCTT-CCAAGCCCTATAATTCCAACAGTTTTGCCACTAAACTTGGT
 
. : . : . : . : . : . :
rJMSF051D22- AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
rJMSF017H05- AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
rJMFF004I24- AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
rJMSF016H05- AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
JMSF051D22+ AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
JMFF021P19+ AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
JMSF017H05+ AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
JMSF016H05+ AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
                      ____________________________________________________________
consensus AGTCAACTTGAAGTTACCCATCTTCCACAACCCTGTCCTCACAAATCGATCACACTCGCA
 
. : . : . : . : . : . :
rJMSF051D22- AATCCTTCTGAGCACAGCCAGCATCAACCCGAT
rJMSF017H05- AATCCTTCTGAGCACAGCCAGCATCAACCCGATT
rJMFF004I24- AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCG
rJMSF016H05- AATCCTTCTGAGCACAGCCAGCATCAACCCGATGGCCANGTCGGCGACGTCCTCCGTCAA
JMSF051D22+ AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCGTCAA
JMFF021P19+ AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCGTCAA
JMSF017H05+ AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCGTCAA
JMSF016H05+ AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCGTCAA
                      ____________________________________________________________
consensus AATCCTTCTGAGCACAGCCAGCATCAACCCGATTGCCAAGTCGGCGACGTCCTCCGTCAA
 
. : . : . : . : . : . :
rJMSF016H05- GACGTCGGGGGTATGGGTA
JMSF051D22+ GACGTCGGGGGTATTGGTAACCCGAATTCCCTTCTCCCTGCACTTGGCCAAGTCGATCTT
JMFF004I24+ TCTCCCTGCNCTTGCCCAAGTCGATCTT
JMFF021P19+ GACGTCGGGGGTATTGGTAACCCGAATTCCCTTCTCCCTGCACTTGGCCAAGTCGATCTT
JMSF017H05+ GACGTCGGGGGTATTGGTAACCCGAATTCCCTTCTCCCTGCACTTGGCCAAGTCGATCTT
JMSF016H05+ GACGTCGGGGGTATTGGTAACCCGAATTCCCTTCTCCCTGCACTTGGCCAAGTCGATCTT
                      ____________________________________________________________
consensus GACGTCGGGGGTATTGGTAACCCGAATTCCCTTCTCCCTGCACTTGGCCAAGTCGATCTT
 
. : . : . : . : . : . :
JMSF051D22+ ATCCAAGCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
JMFF004I24+ ATCCAANCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
JMFF021P19+ ATCCAAGCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
JMSF017H05+ ATCCAAGCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
JMSF016H05+ ATCCAAGCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
                      ____________________________________________________________
consensus ATCCAAGCCGACGCTGAAACTAGAGACTATCTCCAGCTTGGGGAGCGCATCAATCAGCTC
 
. : . : . : . : . : . :
JMSF051D22+ GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
JMFF004I24+ GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
JMFF021P19+ GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
JMSF017H05+ GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
JMSF016H05+ GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
                      ____________________________________________________________
consensus GGCGTCAGCCCCGGCGGAGGCGTTTCCGACGACGGCGCGGATCGCGTTGGCGTTCTCCCT
 
. : . : . : . : . : . :
JMSF051D22+ CAGGAATTCCTTCTTCTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
JMFF004I24+ CAGGAATTCCTTCTTCTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
JMFF021P19+ CAGGAATTCCTTCTTCTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
JMSF017H05+ CAGGAATTCCTTCTTNTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
JMSF016H05+ CAGGAATTCCTTCTTCTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
                      ____________________________________________________________
consensus CAGGAATTCCTTCTTCTGCGGGAAGTTCCAGAAGCGGAAGAGCTTGAACCGCTTGTCGAG
 
. : . : . : . : . : . :
JMSF051D22+ TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
JMFF004I24+ TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
JMFF021P19+ TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
JMSF017H05+ TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
JMSF016H05+ TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
                      ____________________________________________________________
consensus TTCCTGTTCCAAGTAAGGGTTCATCGGAATCGCCATCAGCACTCCAATACTCTCCATTTC
 
. : . : . : . : . : . :
JMSF051D22+ TTCGTCCCAGATCCGGAGAGGACCTCAATTGTGATTTTGCGGT
JMFF004I24+ TTCGTCCCAGATCCGGAGAGGACTTCAATTGTGATTTTGCGGT
JMFF021P19+ TTCGTCCCAGATCCGGAGAGGACTTCAATTGTGATTTTGCGGTGCTTGTGGTTACTGCC
JMSF017H05+ TTCGTCCCAGATCCGGAGAGGACTTCAATTGTGATTTTGCGGTGCTTGTGGTTACTGCC
JMSF016H05+ TTCGTCCCAGATCCGGAGAGGACTTCAATTGTGATTTTGCGGTGCTTGTGGTTACTGCCA
                      ____________________________________________________________
consensus TTCGTCCCAGATCCGGAGAGGACTTCAATTGTGATTTTGCGGTGCTTGTGGTTACTGCCA