Previous Contig 005618:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007K16Sequence380004585 (13)gb:AB082518_15241284e-18Gentiana triflora GtTIP gene for translation-inhibitor protein, complete cds.>gb740005618 (3)gb:BT010507_16404533e-60Arabidopsis thaliana At3g47300 gene, complete cds.>gb:AK175455_1817443 Arabidops
JMSF016G10Sequence509005618 (3)gb:BT010507_16404531e-33Arabidopsis thaliana At3g47300 gene, complete cds.>gb:AK175455_1817443 Arabidops465005618 (3)gb:BT010507_16404537e-34Arabidopsis thaliana At3g47300 gene, complete cds.>gb:AK175455_1817443 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007K16+ CAACAGCCTCAAACCCTAGATTTCCCCACACAG
                      ____________________________________________________________
consensus CAACAGCCTCAAACCCTAGATTTCCCCACACAG
 
. : . : . : . : . : . :
rJMSF007K16+ TCTGCTAGTGGTGGGATTGGTGGAATCGGCCTAGGCAACACTGTCAATANTGATTTCTGC
                      ____________________________________________________________
consensus TCTGCTAGTGGTGGGATTGGTGGAATCGGCCTAGGCAACACTGTCAATANTGATTTCTGC
 
. : . : . : . : . : . :
rJMSF007K16+ TCTTCTTGCTCTTACAGAGGTACTGCTGTGACAATGAAAAACATGTTGGAAACTCAGTTT
                      ____________________________________________________________
consensus TCTTCTTGCTCTTACAGAGGTACTGCTGTGACAATGAAAAACATGTTGGAAACTCAGTTT
 
. : . : . : . : . : . :
rJMSF007K16+ CCTGGCATTCATGTTGTTCTTGCGAACTACCCTGCTCCATTTCCAAAACGTGTGCTAAGC
                      ____________________________________________________________
consensus CCTGGCATTCATGTTGTTCTTGCGAACTACCCTGCTCCATTTCCAAAACGTGTGCTAAGC
 
. : . : . : . : . : . :
rJMSF007K16+ CAACTGGTTCCCATTGTTCAGTTTAGCGTTATTGGTATTATAATGGCTGGTGATCAAATT
rJMSF016G10+ TGGTATTATAATGGCTGGTGATCAAATT
JMSF016G10- TGGTATTATAATGGCTGGTGATCAAATT
                      ____________________________________________________________
consensus CAACTGGTTCCCATTGTTCAGTTTAGCGTTATTGGTATTATAATGGCTGGTGATCAAATT
 
. : . : . : . : . : . :
rJMSF007K16+ TTTCCAAGGTTGGGNTTTGCTGTTCCTCCTCCATGGTATTACAACTTGCGTGCAAATAGA
rJMSF016G10+ TTTCCAAGGTTGGGTTTTGCTGTTCCTCCTCCATGGTATTACAACTTGCGTGCAAATAGA
JMSF016G10- TTTCCAAGGTTGGGTTTTGCTGTTCCTCCTCCATGGTATTACAACTTGCGTGCAAATAGA
                      ____________________________________________________________
consensus TTTCCAAGGTTGGGTTTTGCTGTTCCTCCTCCATGGTATTACAACTTGCGTGCAAATAGA
 
. : . : . : . : . : . :
rJMSF007K16+ TTTGGATCTATGGCAAGCACTTGGCTTCTAGGAAACTTCCTTCAATCAATGCTGCAGAGT
rJMSF016G10+ TTTGGATCTATGGCAAGCACTTGGCTTCTAGGAAACTTCCTTCAATCAATGCTGCAGAGT
JMSF016G10- TTTGGATCTATGGCAAGCACTTGGCTTCTAGGAAACTTCCTTCAATCAATGCTGCAGAGT
                      ____________________________________________________________
consensus TTTGGATCTATGGCAAGCACTTGGCTTCTAGGAAACTTCCTTCAATCAATGCTGCAGAGT
 
. : . : . : . : . : . :
rJMSF007K16+ TCTGGTGCATTCGAAGTGTCTTGTAATGGCGAACTGGTTTTCTCCAAGCTTAAGGAGAAG
rJMSF016G10+ TCTGGTGCATTCGAAGTGTCTTGTAATGGCGAACTGGTTTTCTCCAAGCTTAAGGAGAAG
JMSF016G10- TCTGGTGCATTCGAAGTGTCTTGTAATGGCGAACTGGTTTTCTCCAAGCTTAAGGAGAAG
                      ____________________________________________________________
consensus TCTGGTGCATTCGAAGTGTCTTGTAATGGCGAACTGGTTTTCTCCAAGCTTAAGGAGAAG
 
. : . : . : . : . : . :
rJMSF007K16+ AGGTTTCCTGGCGAAATTGAGTTGAAAGATCTTGTTGGCAGAAGAATTGCAAATGTAAGG
rJMSF016G10+ AGGTTTCCTGGCGAAATTGAGTTGAAAGATCTTGTTGGCAGAAGAATTGCAAATGTAAGG
JMSF016G10- AGGTTTCCTGGCGAAATTGAGTTGAAAGATCTTGTTGGCAGAAGAATTGCAAATGTAAGG
                      ____________________________________________________________
consensus AGGTTTCCTGGCGAAATTGAGTTGAAAGATCTTGTTGGCAGAAGAATTGCAAATGTAAGG
 
. : . : . : . : . : . :
rJMSF007K16+ GCGACAGATGATTTTCTATTGAACTCTCGAAGGGGATAATTTTTATTTCACACATTGTAG
rJMSF016G10+ GCGACAGATGATTTTCTATTGAACTCTCGAAGGGGATAATTTTTATTTCACACATTGTAG
JMSF016G10- GCGACAGATGATTTTCTATTGAACTCTCGAAGGGGATAATTTTTATTTCACACATTGTAG
                      ____________________________________________________________
consensus GCGACAGATGATTTTCTATTGAACTCTCGAAGGGGATAATTTTTATTTCACACATTGTAG
 
. : . : . : . : . : . :
rJMSF007K16+ AAGGAAAAAAATGTTGTTTTAGCATATGTATAATTCCTTGTTTTTGCAGTTTACTTTTGA
rJMSF016G10+ AAGGAAAAAAATGTTGTTTTAGCATACGTATAATTCCTTGTTTTTGCAGTTTACTTTTGA
JMSF016G10- AAGGAAAAAAATGTTGTTTTAGCATACGTATAATTCCTTGTTTTTGCAGTTTACTTTTGA
                      ____________________________________________________________
consensus AAGGAAAAAAATGTTGTTTTAGCATACGTATAATTCCTTGTTTTTGCAGTTTACTTTTGA
 
. : . : . : . : . : . :
rJMSF007K16+ GCTGAGTTGNTANGGTCCAATGCACCTTTTGTAAATTTAGACACTTTTTAACTGCTACAT
rJMSF016G10+ GTTGAGTTGTTATGGTCCAATGCACCTTTTGTAAATTTAGACACTTTTTAACTGCTACAT
JMSF016G10- GTTGAGTTGTTATGGTCCAATGCACCTTTTGTAAATTTAGACACTTTTTAACTGCTACAT
                      ____________________________________________________________
consensus GTTGAGTTGTTATGGTCCAATGCACCTTTTGTAAATTTAGACACTTTTTAACTGCTACAT
 
. : . : . : . : . : . :
rJMSF007K16+ TCACAAGTTCATAAGTTGTCATAGTACCTAATGCTGAATCTTCTCTA
rJMSF016G10+ TCACAAGTTCATAAGT
JMSF016G10- TCACAAGTTCATAAGTTGTCATAGTACCTAATGCTGAATCTTCTCTAGTTCTTTCTCATA
                      ____________________________________________________________
consensus TCACAAGTTCATAAGTTGTCATAGTACCTAATGCTGAATCTTCTCTAGTTCTTTCTCATA