Previous Contig 005617:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS012F10Sequence627005617 (7)pir|G96602|G966021e-47probable receptor protein kinase F14G9.24 [imported] - Arabidopsis thaliana>gb:A
JMFS127H02Sequence588005617 (7)pir|G96602|G966021e-40probable receptor protein kinase F14G9.24 [imported] - Arabidopsis thaliana>gb:A
JMFS141G03Sequence624005617 (7)pir|G96602|G966021e-59probable receptor protein kinase F14G9.24 [imported] - Arabidopsis thaliana>gb:A
JMFS153G12Sequence621005617 (7)gb:AC069159_15406968e-62Arabidopsis thaliana chromosome 1 BAC F14G9 genomic sequence, complete sequence.
JMSF016G05Sequence552005617 (7)gb:AC009894_15368693e-14Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete sequence.715022714gb:AC009894_15368702e-46Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete sequence.
JMSF030P01Sequence436005617 (7)gb:AC009894_15368698e-14Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete sequence.722013220 (3)gb:AC009894_15368701e-49Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete sequence.
JMSF039H04Sequence641005617 (7)pir|G96602|G966027e-45probable receptor protein kinase F14G9.24 [imported] - Arabidopsis thaliana>gb:A820013220 (3)pir|E96602|E966029e-23hypothetical protein T6H22.9 [imported] - Arabidopsis thaliana>gb:AE005173_89349

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS153G12+ AAGAGTATAATANAACTATGCAGATTGGAGCTGATCATGTCTCCTTACAGAT
                      ____________________________________________________________
consensus AAGAGTATAATANAACTATGCAGATTGGAGCTGATCATGTCTCCTTACAGAT
 
. : . : . : . : . : . :
JMFS153G12+ TGCTTAAATTCTTCAAATTCCTAATGAAGTCCAGTGAAGAACTCCCATTCAAAAGATCAC
                      ____________________________________________________________
consensus TGCTTAAATTCTTCAAATTCCTAATGAAGTCCAGTGAAGAACTCCCATTCAAAAGATCAC
 
. : . : . : . : . : . :
JMFS153G12+ TTATCCTCAAGTCAAGCAATGAGGTTAAATTTGAAAATGTAGATGGAATTGGGCCCTGAA
JMFS141G03+ ATGGAATTGGGCCCTGAA
                      ____________________________________________________________
consensus TTATCCTCAAGTCAAGCAATGAGGTTAAATTTGAAAATGTAGATGGAATTGGGCCCTGAA
 
. : . : . : . : . : . :
JMFS153G12+ ATGAATTTCCTTCGAACCTCAAGGTAGTAAGCTTCGACCAATTCCCAATGAAATCAGGTA
JMFS141G03+ ATGAATTTCCTTCAAACCTCAGGTTAGTAAGCTTTGACCAATTCCCAATGAAATCAGGTA
                      ____________________________________________________________
consensus ATGAATTTCCTTCGAACCTCAGGTTAGTAAGCTTTGACCAATTCCCAATGAAATCAGGTA
 
. : . : . : . : . : . :
JMFS153G12+ TCCTCCCTGAAAGTTCAGTGTCTGAAGCCCACACTATTTCTAGATTCAGAAGATTTGCAA
JMFS141G03+ TCCTCCCTGTAAGCTCAGTGTCTGAAGCCCCCACTATTTTTAGGTTCAGTAGATTTGCAA
                      ____________________________________________________________
consensus TCCTCCCTGTAAGTTCAGTGTCTGAAGCCCCCACTATTTTTAGGTTCAGTAGATTTGCAA
 
. : . : . : . : . : . :
JMFS153G12+ ATGTTGGAGGTATAGCACCACTAACACCAGAACTATCTATGTAGAGTTGTGTTAGTTTTT
JMFS141G03+ ATGTTGGAGGTATAGGACCACTAACACCGGAGCTATCTATATAGAGTTCTGTTAGATTTC
                      ____________________________________________________________
consensus ATGTTGGAGGTATAGGACCACTAACACCGGAGCTATCTATGTAGAGTTGTGTTAGTTTTT
 
. : . : . : . : . : . :
JMFS153G12+ TCAAATTTCCAAGCTCTGAAGGCAAAGGCCCAAAAAAATTATTTGTGCCAATGGACAAGG
JMFS141G03+ TCAAATTCCCTAGCTCCAAAGGCAAAGGTCCAGAAAAGTTATTTGTGCTAATGGAAAAGG
JMFS012F10+ GTCCAGAAAAGTTATNTGTGCTAATGGAAAGGG
JMFS127H02+ AGTTATTTGTGCTAATGAAAAGGG
JMSF039H04+ AAAAGTTATTTGTGNTAATGGAAAGGG
                      ____________________________________________________________
consensus TCAAATTTCCTAGCTCTGAAGGCAAAGGTCCAGAAAAGTTATTTGTGCTAATGGAAAGGG
 
. : . : . : . : . : . :
JMFS153G12+ ATCTTAAGTCAGTTAGCAATCCAAGTTCCTTTGGAAGCTCCCCCGACAAAGCATTAATGC
JMFS141G03+ CTCTTAAGTCAGTCAGCAAACCGAGTGCCACTGGAAGCTCCCCTGACAGTGCATTAATGC
JMFS012F10+ ATCTTAAGTCAGTCAGCAATCCAAGTTCCTTTGGAAGCTCCCCTGACAATGCATTCTTGC
JMFS127H02+ ATCTTAGTCAAGTCAGCAATCCAAGTTCCTTTGGAAGCTCCCCTGACAATGCATTCTTGC
JMSF039H04+ ATCTTAAGTCAGTCAGCAATCCAAGTTCCTTTGGAAGCTCCCCTGACAATGCATTCTTGC
                      ____________________________________________________________
consensus ATCTTAAGTCAGTCAGCAATCCAAGTTCCTTTGGAAGCTCCCCTGACAATGCATTCTTGC
 
. : . : . : . : . : . :
JMFS153G12+ CCAGG---AAGTATTTCATACGAATCAAATTTCCAATGGAGGGGGACAGTTTGCCTGTCA
JMFS141G03+ CTAGGGCTAGGTATTGCAACCGATGCAAATTTCCAATGGAGGGGGATAGTGTGCCAGTCA
JMFS012F10+ CTACGCTTAGGTATTGCATACGACGCAAATTTCCAATAGAGCGGGACAGTGTGCCATTCA
JMFS127H02+ CTACGCTTAGGTATTGCATACGACGCAAATTTCCAATAGAGCGGGACAGTGTGCCATTCA
JMSF039H04+ NTACGCTTAGGTATTGCATACGACGCAAATTTCCAATAGAGCGGGACAGTGTGCCATTCA
                      ____________________________________________________________
consensus CTACGCTTAGGTATTGCATACGACGCAAATTTCCAATAGAGCGGGACAGTGTGCCATTCA
 
. : . : . : . : . : . :
JMFS153G12+ AGTAATTTTGGCCTAGATTTAG
JMFS141G03+ AGTAATTTTTGCCAAGATTTAGATCAATGATGGAAGTTAGGCTCCAAAGTTGATTTGGAA
JMFS012F10+ AGTAATTTTGGCCAAGATTTAGATCATTGATGGAAGTTAGGTTCCAAAGTTCATCTGGAA
JMFS127H02+ AGTAATTTTGGCCAAGATTTAGATCATTGATGGAAGTTAGGTTCCAAAGTTCATCTGGAA
JMSF039H04+ AGTAATTTTGGCCAAGATTTAGATCATTGATGGAAGTTAGGTTCCAAAGTTCATCTGGAA
                      ____________________________________________________________
consensus AGTAATTTTGGCCAAGATTTAGATCATTGATGGAAGTTAGGTTCCAAAGTTCATCTGGAA
 
. : . : . : . : . : . :
JMFS141G03+ TCGCACCAGTAACGTTCAACTCGTAAACTTTCAGGACAGTGATGTGGCAAGGGTTGGAAG
JMSF030P01+ CCTGAACTTTCAGGGCAGTGATGTGGCAAACGGTGGAAG
JMFS012F10+ TGCCACCAGTAACGTCTAGCGCCTGAACTTTCAGGGCAGTGATGTGGCAAACGGTGGAAG
JMFS127H02+ TGCCACCAGTAACGTCTAGCGCCTGAACTTTCAGGGCAGTGATGTGGCAAACGGTGGAAG
JMSF039H04+ TGCCACCAGTAACGTCTAGCGCCTGAACTTTCAGGGCAGTGATGTGGCAAACGGTGGAAG
JMSF016G05+ CAGGGCAGTGATGTGGCAAACGGTGGAAG
                      ____________________________________________________________
consensus TGCCACCAGTAACGTCTAGCGCCTGAACTTTCAGGGCAGTGATGTGGCAAACGGTGGAAG
 
. : . : . : . : . : . :
JMFS141G03+ AGCAATCGCATTTGATTGCCGGATTGAAAGAGCTGTCTTGCGTACTGGTAGAATCGACGG
JMSF030P01+ AACAAGTGCATTTGATTGCGGGATNGTAAGCGGTGTCTTGCATGCTGGTAGAATCGACGG
JMFS012F10+ AACAAGTGCATTTGATTGCGGGATTGTAAGCGGTGTCTTGCATGCTGGTAGAATCGACGG
JMFS127H02+ AACAAGTGCATTTGATTGCGGGATTGTAAACGGTGTCTTGCATGCTGGTAGAATCGACGG
JMSF039H04+ AACAAGTGCATTTGATTGCGGGATTGTAAGCGGTGTCTTGCATGCTGGTAGAATCGACGG
JMSF016G05+ AACAAGTGCATTTGATTGCGGGATTGTAAGCGGTGTCTTGCATGCTGGTAGAATCGACGG
                      ____________________________________________________________
consensus AACAAGTGCATTTGATTGCGGGATTGTAAGCGGTGTCTTGCATGCTGGTAGAATCGACGG
 
. : . : . : . : . : . :
JMFS141G03+ CGAAGCCAGTGCACAATTCTCCACTTATGTTCCATTGCTGATTGTTGGCCCGAATCCCCC
JMSF030P01+ CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
JMFS012F10+ CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
JMFS127H02+ CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
JMSF039H04+ CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
JMSF016G05+ CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
                      ____________________________________________________________
consensus CGAAGCCAGTGCACAGTTGTCCACTCAAGTTCCAATGCAGATTGTTGGCCAGAATTCCCC
 
. : . : . : . : . : . :
JMFS141G03+ ATT
JMSF030P01+ ATTTNTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCAACAGTGGCG
JMFS012F10+ ATTTTTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCAACAGTGGCGGTGGTCT
JMFS127H02+ ATTTTTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCACCAGTGGCGGTGGTAT
JMSF039H04+ ATTTTTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCAACAGTGGCGGTGGTCT
JMSF016G05+ ATTTTTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCAACAGTGGCGGTGGTCT
                      ____________________________________________________________
consensus ATTTTTGGAATATGGAGTTCAAAATCCTAGCTTCAGTGGGATCAACAGTGGCGGTGGTCT
 
. : . : . : . : . : . :
JMFS012F10+ GAGCTCTAGCCGCCGGAAGAAGCTGCTGGTCGGCGATGGCAATTGCTATAATAATAATGG
JMFS127H02+ GAGCTCTAGCCGCCGGAAGAAGCTGCTGGTCGGCGATGGCAATTGCTATAATAATAATGG
JMSF039H04+ GAGCTCTAGCCGCCGGAAGAAGCTGCTGGTCGGCGATGGCAATTGCTATAATAATAATGG
JMSF016G05+ GAGCTCTAGCCGCCGGAAGAAGCTGCTGGTCGGCGATGGCAATTGCTATAATAATAATGG
                      ____________________________________________________________
consensus GAGCTCTAGCCGCCGGAAGAAGCTGCTGGTCGGCGATGGCAATTGCTATAATAATAATGG
 
. : . : . : . : . : . :
JMFS012F10+ TGATGATGTAGAAGCTCGCGCCGTACTTCATCGGACCAACTCCACTTGCCACCAACTTCC
JMFS127H02+ TGATGATGTAGAAGCTCGCGCCGTACTTCATCGGACCAACTCCACTTGCCACCAACTTCC
JMSF039H04+ TGATGATGTAGAAGCTCGCGCCGTACTTCATCGGACCAACTCCACTTGCCACCAACTTCC
JMSF016G05+ TGATGATGTAGAAGCTCGCGCCGTACTTCATCGGACCAACTCCACTTGCCACCAACTTCC
                      ____________________________________________________________
consensus TGATGATGTAGAAGCTCGCGCCGTACTTCATCGGACCAACTCCACTTGCCACCAACTTCC
 
. : . : . : . : . : . :
JMFS012F10+ CCTTCATCTGGAAAACAA
JMFS127H02+ CCTTCATCTGGAAAACAACTCCGT
JMSF039H04+ CCTTCATCTGGAAAACAACTCCGTGTGACTGAGAGAGAGAGAGAGAGAATGTGTTTGCC
JMSF016G05+ CCTTCATCTGGAAAACAACTCCGTGTGACTGAGAGAGAGAGAGAGAGAATGTGTTTGCCC
                      ____________________________________________________________
consensus CCTTCATCTGGAAAACAACTCCGTGTGACTGAGAGAGAGAGAGAGAGAATGTGTTTGCCC