Previous Contig 005615:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041E07Sequence360005615 (4)575021606gb:AY085046_15701287e-11Arabidopsis thaliana clone 12566 mRNA, complete sequence.
JMSF003L20Sequence331005615 (4)718011278 (3)gb:AC149267_17448793e-07Solanum demissum chromosome 5 clone PGEC747E24 map MAP_LOC, complete sequence.
JMSF016F18Sequence540005615 (4)752011278 (3)gb:AC007730_15361594e-06Arabidopsis thaliana chromosome 2 BAC T5M2 genomic sequence, complete sequence.
JMSF033K16Sequence654005615 (4)748011278 (3)gb:AC149267_17448793e-07Solanum demissum chromosome 5 clone PGEC747E24 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033K16+ TGCAATCGTTCTCAGATGAGAATCGTAGCAAGACAGTTCTCCGATTCAGATTCGCG
                      ____________________________________________________________
consensus TGCAATCGTTCTCAGATGAGAATCGTAGCAAGACAGTTCTCCGATTCAGATTCGCG
 
. : . : . : . : . : . :
JMSF033K16+ CCTGGCAGAGAATTTGTTTGATCCAGAAACTCTCGCTCAATTGAGTCCACGCACTTCAAA
                      ____________________________________________________________
consensus CCTGGCAGAGAATTTGTTTGATCCAGAAACTCTCGCTCAATTGAGTCCACGCACTTCAAA
 
. : . : . : . : . : . :
JMSF033K16+ GCTATGGCTCTCTGAGCGTATTTCAGATGGAGATATACAACCGCTGCGGCTGATTGCTCC
                      ____________________________________________________________
consensus GCTATGGCTCTCTGAGCGTATTTCAGATGGAGATATACAACCGCTGCGGCTGATTGCTCC
 
. : . : . : . : . : . :
JMSF033K16+ AAACTCGGAATCCTCTGCGGATTGACCGGAATCGACGAAGCTCCTCCCTTCCACTGCGGA
JMSF016F18+ TCGGAATCCTNTGCGGATTGACCGGAATCGACGAAGCTCCTCCCTTCCACTGCGGA
                      ____________________________________________________________
consensus AAACTCGGAATCCTCTGCGGATTGACCGGAATCGACGAAGCTCCTCCCTTCCACTGCGGA
 
. : . : . : . : . : . :
JMSF033K16+ ACGGCTACGGCTATGGCTCCCTGAACGTATTAGAGATGGAAATATACAACCGCTGCGGCT
JMFF041E07+ GATGGAAATATACAACCGCTGCGGCT
JMSF016F18+ ACGGCTACGGCTATGGCTCCCTGAACGTATTAGAGATGGAAATATACAACCGCTGCGGCT
                      ____________________________________________________________
consensus ACGGCTACGGCTATGGCTCCCTGAACGTATTAGAGATGGAAATATACAACCGCTGCGGCT
 
. : . : . : . : . : . :
JMSF033K16+ GTTTGCTCCAAATTCGGAGATTGAACGATCGGATGAGCTCCTTCCTTCCCCTTCGGAACG
JMSF003L20+ AACGATCGGATGAGCTCCTTCCTTCCCCTTCGGAACG
JMFF041E07+ GTTTGCTCCAGATTCGGAGATTGAACGATCGGACGAGCTCCTTCCTTCCCCTTAGAAACG
JMSF016F18+ GTTTGCTCCAAATTCGGAGATTGAACGATCGGATGAGCTCCTTCCTTCCCCTTCGGAACG
                      ____________________________________________________________
consensus GTTTGCTCCAAATTCGGAGATTGAACGATCGGATGAGCTCCTTCCTTCCCCTTCGGAACG
 
. : . : . : . : . : . :
JMSF033K16+ GTTGTGGAGTTCGCCTGAGATCGACTTGGAATCCACGGATCTCCTTCCTTCCGCTGCGGA
JMSF003L20+ GTTGTGGAGTTCGCCTGAGATCGACTTGGAATCCACGGATCTCCTTCCTTCCGCTGCGGA
JMFF041E07+ GTTGTGGAGTTCGCCTGAGATCGTCTTGGAATCCACGGATCTCCTTCCTTCCGCTGCGGA
JMSF016F18+ GTTGTGGAGTTCGCCTGAGATCGACTTGGAATCCACGGATCTCCTTCCTTCCGCTGCGGA
                      ____________________________________________________________
consensus GTTGTGGAGTTCGCCTGAGATCGACTTGGAATCCACGGATCTCCTTCCTTCCGCTGCGGA
 
. : . : . : . : . : . :
JMSF033K16+ AGAGCTATGGAGATCGACGATGGACAGACTCGGATCGCCTTAGCATAGGCTTTGTTGCTA
JMSF003L20+ AGAGCTATGGAGATCGACGATGGACAGACTCGGATCGCCTTAGCATAGGCTTTGTTGCTA
JMFF041E07+ AGAGCTATGGAGATCGACGATGGACAGACTCGGATCGTCTTAGCATAGGCTTTGTTGCTA
JMSF016F18+ AGAGCTATGGAGATCGACGATGGACAGACTCGGATCGCCTTAGCATAGGCTTTGTTGCTA
                      ____________________________________________________________
consensus AGAGCTATGGAGATCGACGATGGACAGACTCGGATCGCCTTAGCATAGGCTTTGTTGCTA
 
. : . : . : . : . : . :
JMSF033K16+ CGCATCCTCTGCGGATGGACTAGGATTGCACGGCGTCGCTTCACTTCATCGACTTCTCCG
JMSF003L20+ CGCATCCTCTGCGGATGGACTAGGATTGCACGGCGTCGCTTCACTTCATCGACTTCTCCG
JMFF041E07+ CGCATCCTCTGCGGATGGA
JMSF016F18+ CGCATCCTCTGCGGATGGACTAGGATTGCACGGCGTCGCTTCACTTCATCGACTTCTCCG
                      ____________________________________________________________
consensus CGCATCCTCTGCGGATGGACTAGGATTGCACGGCGTCGCTTCACTTCATCGACTTCTCCG
 
. : . : . : . : . : . :
JMSF033K16+ GCACCGGAAAAAGTAACAGCGTGGATGAGCCCCCGCCGCTCTGATACCATGTCGGAATAT
JMSF003L20+ GCACCGGAAAAAGTAACAGCGTGGATGAGCCCCCGCCGCTCTGATACCATGTCGGAATAT
JMSF016F18+ GCACCGGAAAAAGTAACAGCGTGGATGAGCCCCCGCCGCTCTGATACCATGTCGGAATAT
                      ____________________________________________________________
consensus GCACCGGAAAAAGTAACAGCGTGGATGAGCCCCCGCCGCTCTGATACCATGTCGGAATAT
 
. : . : . : . : . : . :
JMSF033K16+ GGACTACATGATGAAGCAGAGAGAAGAAGCCGAGAGAAGAAGATGATATTATT
JMSF003L20+ GGACTACATGATGAAGCAGAGAGAAGAAGCCGAGAGAAGAAGATGATATTATT
JMSF016F18+ GGACTACATGATGAAGCAGAGAGAAGAAGCCGAGAGAAGAAGATGATATTATTGATCCAA
                      ____________________________________________________________
consensus GGACTACATGATGAAGCAGAGAGAAGAAGCCGAGAGAAGAAGATGATATTATTGATCCAA