Previous Contig 005612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005C02Sequence472005612 (4)sp|P51567|AFC2_ARATH1e-06Protein kinase AFC2 (EC 2.7.1.-).>pir|T05560|T05560 protein kinase AFC2 (EC 2.7.
JMFS005G07Sequence472005612 (4)sp|P51567|AFC2_ARATH1e-06Protein kinase AFC2 (EC 2.7.1.-).>pir|T05560|T05560 protein kinase AFC2 (EC 2.7.
JMFS128H05Sequence131005612 (4)sp|P51567|AFC2_ARATH0.006Protein kinase AFC2 (EC 2.7.1.-).>pir|T05560|T05560 protein kinase AFC2 (EC 2.7.
JMSF016F06Sequence241005612 (4)sp|P51567|AFC2_ARATH9e-07Protein kinase AFC2 (EC 2.7.1.-).>pir|T05560|T05560 protein kinase AFC2 (EC 2.7.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS005G07+ TCAAAATTT
JMFS005C02+ TCAAAATTT
                      ____________________________________________________________
consensus TCAAAATTT
 
. : . : . : . : . : . :
JMFS005G07+ TGGCATGTTTACTATGCAATTAAGATTTAAATACCGCACAAGATACACGGAGCTTACAAC
JMFS005C02+ TGGCATGTTTACTATGCAATTAAGATTTAAATACCGCACAAGATACACGGAGCTTACAAC
                      ____________________________________________________________
consensus TGGCATGTTTACTATGCAATTAAGATTTAAATACCGCACAAGATACACGGAGCTTACAAC
 
. : . : . : . : . : . :
JMFS005G07+ AACCTTAATCCCTAAATATCTAACTTAAAAATTATGATTTATAGATAGATATGTATATAG
JMFS005C02+ AACCTTAATCCCTAAATATCTAACTTAAAAATTATGATTTATAGATAGATATGTATATAG
                      ____________________________________________________________
consensus AACCTTAATCCCTAAATATCTAACTTAAAAATTATGATTTATAGATAGATATGTATATAG
 
. : . : . : . : . : . :
JMFS005G07+ ATCTTTACATAGTCAAAACTATGTGCATAAAATTTCAGGAAAAACACATGTTAATCATAC
JMFS005C02+ ATCTTTACATAGTCAAAACTATGTGCATAAAATTTCAGGAAAAACACATGTTAATCATAC
                      ____________________________________________________________
consensus ATCTTTACATAGTCAAAACTATGTGCATAAAATTTCAGGAAAAACACATGTTAATCATAC
 
. : . : . : . : . : . :
JMFS005G07+ CTGACGCGATAAAGAATCTAATCTTTGATGAGATCTAGCAAAAACAGAAGCGAAATTCGX
JMFS005C02+ CTGACGCGATAAAGAATCTAATCTTTGATGAGATCTAGCAAAAACAGAAGCGAAATNCGX
                      ____________________________________________________________
consensus CTGACGCGATAAAGAATCTAATCTTTGATGAGATCTAGCAAAAACAGAAGCGAAATTCGN
 
. : . : . : . : . : . :
JMFS005G07+ XXXXXXXXXXXXXXXXXXXCGTAAAACTTGAAGAGATCAAAGAATTCCAAGGTCGGAACG
JMFS128H05+ CGTAAAACTTGAAGAGATCAAAGAATTCCAAGGTCGGAACG
JMFS005C02+ XXXXXXXXXXXXXXXXXXXCGTAAAACTTGAAGAGATCAAAGAATTCCAAGGTCGGAACG
JMSF016F06+ CGTAAAACTTGAAGAGATCAAAGAATTCCAAGGTCGGAACG
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNCGTAAAACTTGAAGAGATCAAAGAATTCCAAGGTCGGAACG
 
. : . : . : . : . : . :
JMFS005G07+ TGTTTTTACCTTAGGGACCTCAGGGAGGACGTCCCAGCCCAATCGAGGCCGCTTCCGTGG
JMFS128H05+ TGTTTTTACCTTAGGGACCTCAGGGAGGACGTCCCAGCCCAATCGAGACCGCTTCCGTGG
JMFS005C02+ TGTTTTTACCTTAGGGACCTCAGGGAGGACGTCCCAGCCCAATCGAGGCCGCTTCCGTGG
JMSF016F06+ TGTTTTTACCTTAGGGACCTCAGGGAGGACGTCCCAGCCCAATCGAGGCCGCTTCCGTGG
                      ____________________________________________________________
consensus TGTTTTTACCTTAGGGACCTCAGGGAGGACGTCCCAGCCCAATCGAGGCCGCTTCCGTGG
 
. : . : . : . : . : . :
JMFS005G07+ TCGCCGGTCGAGTTGCGGGAGGGGAAACTCGGTCACGCGCTCTGTCTCCATCGTTGCAGA
JMFS128H05+ TCGCCGGTCGAG
JMFS005C02+ TCGCCGGTCGAGTTGCGGGAGGGGAAACTCGGTCACGCGCTCTGTCTCCATCGTTGCAGA
JMSF016F06+ TCGCCGGTCGAGTTGCGGGAGGGGAAACTCGGTCACGCGCTCTGTCTCCATCGTTGCAGA
                      ____________________________________________________________
consensus TCGCCGGTCGAGTTGCGGGAGGGGAAACTCGGTCACGCGCTCTGTCTCCATCGTTGCAGA
 
. : . : . : . : . : . :
JMFS005G07+ GAAATTTAGAAAGAGAGAGAAAGTTGAAGGAGATGATGATAGA
JMFS005C02+ GAAATTTAGAAAGAGAGAGAAAGTTGAAGGAGATGATGATAGA
JMSF016F06+ GAAATTTAGAAAGAGAGAGAAAGTTGAAGGAGATGATGATAGAGAGAATAAGGATGCGCC
                      ____________________________________________________________
consensus GAAATTTAGAAAGAGAGAGAAAGTTGAAGGAGATGATGATAGAGAGAATAAGGATGCGCC