Previous Contig 005611:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006P06Sequence328005611 (4)
JMSF008M12Sequence157005611 (4)748011879 (4)gb:AY128290_15805913e-47Arabidopsis thaliana AT3g60070/T2O9_50 mRNA, complete cds.>gb:BT002653_1636256 A
JMSF016F03Sequence196005611 (4)749011879 (4)gb:AY128290_15805913e-51Arabidopsis thaliana AT3g60070/T2O9_50 mRNA, complete cds.>gb:BT002653_1636256 A
JMSF030D14Sequence156005611 (4)679011879 (4)gb:AY128290_15805912e-38Arabidopsis thaliana AT3g60070/T2O9_50 mRNA, complete cds.>gb:BT002653_1636256 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030D14+ AAAAAAAAAAAACAAACAAAAAACAA
JMSF008M12+ TTTTAAAAAAAAAAAAACAAACAAAAAACAA
                      ____________________________________________________________
consensus TTTTAAAAAAAAAAAAACAAACAAAAAACAA
 
. : . : . : . : . : . :
JMSF030D14+ AAAACAAATTCATACCCAGATCAACAAGCAAAGTAGAAGCAAGAGCAG-AAATGACGCTT
JMSF008M12+ AAAACAAATTCATACCCAGATCAACAAGCAAAGTAGAAGCAAGAGCAG-AAATGACGCTT
JMSF006P06+ AAGTAGAAGCAAGAGCAGNAAATGACGCTT
                      ____________________________________________________________
consensus AAAACAAATTCATACCCAGATCAACAAGCAAAGTAGAAGCAAGAGCAG-AAATGACGCTT
 
. : . : . : . : . : . :
JMSF030D14+ ATCCAAGACTGGCGGAAATGGCGATTGACGTGGAAAGAAAATGGGCGGAGTAAGAGTCAA
JMSF008M12+ ATCCAAGACTGGCGGAAATGGCGATTGACGTGGAAAGAAAATGGGCGGAGTAAGAGTCAA
JMSF006P06+ ATCCAAGACTGGCGGAAATGGCGATTGACGTGGAAAGAAAATGGGCGGAGTAAGAGTCAA
                      ____________________________________________________________
consensus ATCCAAGACTGGCGGAAATGGCGATTGACGTGGAAAGAAAATGGGCGGAGTAAGAGTCAA
 
. : . : . : . : . : . :
JMSF030D14+ GGCAGC
JMSF008M12+ GGCAGC
JMSF006P06+ GGCAGCTCCTTTTTTGTCTCGTCCCGCTTAATCGTCTTTGATTTCCACCATAAACATATA
JMSF016F03+ CCACCATAAACATATA
                      ____________________________________________________________
consensus GGCAGCTCCTTTTTTGTCTCGTCCCGCTTAATCGTCTTTGATTTCCACCATAAACATATA
 
. : . : . : . : . : . :
JMSF006P06+ ATATATTTTTTTTCTTTCTCTATTTTGATTGAATGGGTTTCCAAATGGATTGGGATTCCG
JMSF016F03+ ATATATTTTTTTTCTTTCTCTATTTTGATTGAATGGGTTTCCAAATGGATTGGGATTCCG
                      ____________________________________________________________
consensus ATATATTTTTTTTCTTTCTCTATTTTGATTGAATGGGTTTCCAAATGGATTGGGATTCCG
 
. : . : . : . : . : . :
JMSF006P06+ ACTAGACAGCAGCCTTTATCCACTTGCGTGCCATTCTTGCCAGTTTCCCAGTATTACTTT
JMSF016F03+ ACTAGACAGCAGCCTTTATCCACTTGCGTGCCATTCTTGCCAGTTTCCCAGTATTACTTT
                      ____________________________________________________________
consensus ACTAGACAGCAGCCTTTATCCACTTGCGTGCCATTCTTGCCAGTTTCCCAGTATTACTTT
 
. : . : . : . : . : . :
JMSF006P06+ TCATTCTGAAAGCCTTTGCATGGAAACGTACGCCACCACCCCCACAATCTCTGC
JMSF016F03+ TCATTCTGAAAGCCTTTGCATGGAAACGTACGCCACCACCCCCACAATCTCTGCTCTCCC
                      ____________________________________________________________
consensus TCATTCTGAAAGCCTTTGCATGGAAACGTACGCCACCACCCCCACAATCTCTGCTCTCCC