Previous Contig 005609:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS081E08Sequence627005609 (2)gb:AY830138_16293402e-27Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMSF016E13Sequence550005609 (2)gb:AY830138_16293403e-24Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS081E08+ CCAACAATGAAGACCAAATTTATCTTATTATTA
                      ____________________________________________________________
consensus CCAACAATGAAGACCAAATTTATCTTATTATTA
 
. : . : . : . : . : . :
JMFS081E08+ AAAGAGGGTGAGAAGTAGCTGCTGGAGATGAAAAAATTACTAAAAGACTTTGGGATGAGA
                      ____________________________________________________________
consensus AAAGAGGGTGAGAAGTAGCTGCTGGAGATGAAAAAATTACTAAAAGACTTTGGGATGAGA
 
. : . : . : . : . : . :
JMFS081E08+ TTGTTGATTATCTCTTCACGATCACGGTGACGACCCACCATTTTTCCGCCCACAAGCTCA
JMSF016E13+ TGATTATNTNTTCACGATCATGGNGACGACCCACCATTTTTCCACCCACAAGCTCA
                      ____________________________________________________________
consensus TTGTTGATTATCTCTTCACGATCATGGTGACGACCCACCATTTTTCCGCCCACAAGCTCA
 
. : . : . : . : . : . :
JMFS081E08+ GGAAAGCACTGTGAGGATACATCAAATTTATCATTCCCAAACTCCGAATAAGCATGCTTT
JMSF016E13+ GGAAAGCACGGTGAGGATCCATCAAATTTATCATTCTCAAACTCCGAATAAGAACGCTTT
                      ____________________________________________________________
consensus GGAAAGCACTGTGAGGATCCATCAAATTTATCATTCTCAAACTCCGAATAAGCATGCTTT
 
. : . : . : . : . : . :
JMFS081E08+ AGCCAATGATGAATTGATGGTTGTTGAATTTCATTCTCCTCATCATCATCCGCTTCATTG
JMSF016E13+ AGCCAATGATGAATTGATG---GTTGAATTTCATTCTCC---TCATCATCCGCTTCATTG
                      ____________________________________________________________
consensus AGCCAATGATGAATTGATGGTTGTTGAATTTCATTCTCCTCATCATCATCCGCTTCATTG
 
. : . : . : . : . : . :
JMFS081E08+ CTTACCTTGTCGATAATACTCAACAACTCTGATGCGTTTTCTGCTGCTTCTTGCAAGGCT
JMSF016E13+ CTTACCTTGTCGATAATACTCAACAACTCTGATGCGCTTTCTGCTGCTTCTTGCAAGGCT
                      ____________________________________________________________
consensus CTTACCTTGTCGATAATACTCAACAACTCTGATGCGTTTTCTGCTGCTTCTTGCAAGGCT
 
. : . : . : . : . : . :
JMFS081E08+ TGATGGAGTTGCTGGGAAGCTTTTTCCTGATCCTCTTTGTCTTTGGCCAACACAAAGTTG
JMSF016E13+ TGATGGAGTTGCTGGGAAGCTTTTTCCTCATCCTCTTTGTCTTTGGCCAACACAAAGTTG
                      ____________________________________________________________
consensus TGATGGAGTTGCTGGGAAGCTTTTTCCTGATCCTCTTTGTCTTTGGCCAACACAAAGTTG
 
. : . : . : . : . : . :
JMFS081E08+ CGTAGTTGTATTTCGATGTTGTCTTCGGCTTTGAGTGCAAAGTCTCTGATTTTGATTTCC
JMSF016E13+ CTTAGCTGTATTTCGATGTTGTCTTCGGCTTTGAGTGCAAAGTCTCTGATTTCGATTTCC
                      ____________________________________________________________
consensus CTTAGTTGTATTTCGATGTTGTCTTCGGCTTTGAGTGCAAAGTCTCTGATTTTGATTTCC
 
. : . : . : . : . : . :
JMFS081E08+ AAATCCTTGATTGCAGCAGCACCCCTGGATTCCTTTAGAAAGGCTTGCAAAGAAGAAATC
JMSF016E13+ AAATCCTTGATTGCAGCAGCAGCCCTGGATTCCTTTAGAAAGGCTTGCAAAGAAGAAATC
                      ____________________________________________________________
consensus AAATCCTTGATTGCAGCAGCAGCCCTGGATTCCTTTAGAAAGGCTTGCAAAGAAGAAATC
 
. : . : . : . : . : . :
JMFS081E08+ ATTCGCAAGAAAGAATGGATTATTGGTTCTTGATGATGAAGAAGAGGGACCCTTGGGAAG
JMSF016E13+ ATTTGCAAGAAAGAATGGATTATTGGTTCTTGATGAT---GAAGAGGGATCCTTGGGAAG
                      ____________________________________________________________
consensus ATTTGCAAGAAAGAATGGATTATTGGTTCTTGATGATGAAGAAGAGGGATCCTTGGGAAG
 
. : . : . : . : . : . :
JMFS081E08+ GGTTGTAGAAACTCAAGCTGAATTGTTGACTTGAGAGAAGATAAAGCAACACAA
JMSF016E13+ GGTTGTAGAAACTCAAGCTTGATTGTTGCAATCAGAGAAGCTAAAGCAACACAATCCACC
                      ____________________________________________________________
consensus GGTTGTAGAAACTCAAGCTTGATTGTTGCCTTGAGAGAAGCTAAAGCAACACAATCCACC