Previous Contig 005606:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030C12Sequence553005606 (10)gb:AY084768_15698523e-32Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A709005606 (10)gb:AP000600_18203685e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MAG2.
JMFN009G16Sequence560005606 (10)gb:AC022492_15390622e-26Genomic sequence for Arabidopsis thaliana BAC F1L3 from chromosome I, complete s
JMSF016E08Sequence294005606 (10)748005606 (10)gb:AY084768_15698526e-52Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A
JMSF025L08Sequence655005606 (10)gb:AY084768_15698523e-38Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A776005606 (10)gb:AY084768_15698527e-52Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A
JMSF027K15Sequence662019480gb:AC022492_15390626e-15Genomic sequence for Arabidopsis thaliana BAC F1L3 from chromosome I, complete s782005606 (10)gb:AC022492_15390621e-65Genomic sequence for Arabidopsis thaliana BAC F1L3 from chromosome I, complete s
JMSF042F24Sequence654005606 (10)gb:AY084768_15698523e-38Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A760005606 (10)gb:AY084768_15698526e-52Arabidopsis thaliana clone 117369 mRNA, complete sequence.>gb:BT002795_1636394 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027K15+ AAAGGGATATATTCTC
                      ____________________________________________________________
consensus AAAGGGATATATTCTC
 
. : . : . : . : . : . :
rJMSF027K15+ GTGGAACATGATGATTTCAGGCTATGGAATGCACGGCCATGGTGATCGTGCTCTGGAAAC
                      ____________________________________________________________
consensus GTGGAACATGATGATTTCAGGCTATGGAATGCACGGCCATGGTGATCGTGCTCTGGAAAC
 
. : . : . : . : . : . :
rJMSF027K15+ CTTTGATCAGATGATTAAAGCTGGATTTAAACCAGACGAGGTTTCTATGGTGGCAATTCT
                      ____________________________________________________________
consensus CTTTGATCAGATGATTAAAGCTGGATTTAAACCAGACGAGGTTTCTATGGTGGCAATTCT
 
. : . : . : . : . : . :
rJMSF027K15+ CTCGGCATGTGGTCATGCAGGGCTCGTTAGTCAGGGCCGCAAACTTTTTGATCAAATGAG
                      ____________________________________________________________
consensus CTCGGCATGTGGTCATGCAGGGCTCGTTAGTCAGGGCCGCAAACTTTTTGATCAAATGAG
 
. : . : . : . : . : . :
rJMSF027K15+ AACACGATTTGAGATTGAACCACAGGTGGAGCATTATGCTTGTATGGTCGATCTTCTGGG
                      ____________________________________________________________
consensus AACACGATTTGAGATTGAACCACAGGTGGAGCATTATGCTTGTATGGTCGATCTTCTGGG
 
. : . : . : . : . : . :
rJMSF027K15+ CCGAGCTGGATTGATGCAAGAGGCTCACGACATTGTGCAAAACATGCCGATGAAACCCAA
JMFN009G16+ AA
                      ____________________________________________________________
consensus CCGAGCTGGATTGATGCAAGAGGCTCACGACATTGTGCAAAACATGCCGATGAAACCCAA
 
. : . : . : . : . : . :
rJMSF027K15+ CGCCTGTGTTTGGGGCGCGCTATTGAACTCGTGTAGAATGCATAAAAACACACAAGTTGC
JMFN009G16+ CGCCTGTGTTTGGGGCGCGCTATTGAACTCGTGTAGAATGCATAAAAACACACAAGTTGC
                      ____________________________________________________________
consensus CGCCTGTGTTTGGGGCGCGCTATTGAACTCGTGTAGAATGCATAAAAACACACAAGTTGC
 
. : . : . : . : . : . :
rJMSF027K15+ AGAGAAGGCTGCTGCTCAAATTCTCAATCTTGATTCTGAGATGACAGGGAGCTACATGTT
JMFN009G16+ AGAGAAGGCTGCTGCTCAAATTCTCAATCTTGATTTTGAGATGACAGGGAGCTACATGTT
                      ____________________________________________________________
consensus AGAGAAGGCTGCTGCTCAAATTCTCAATCTTGATTTTGAGATGACAGGGAGCTACATGTT
 
. : . : . : . : . : . :
rJMSF027K15+ GCTTTGTAACTTGTATGCTGGCTGTAGAAGATGGGATGACTCTGCAAATGTCAGACTTTC
JMFN009G16+ GCTTTGTAACTTGTATGCTGGCTGTAGAAGATGGGATGACTCTGCAAATGTCAGACTTTC
                      ____________________________________________________________
consensus GCTTTGTAACTTGTATGCTGGCTGTAGAAGATGGGATGACTCTGCAAATGTCAGACTTTC
 
. : . : . : . : . : . :
rJMSF027K15+ AGCAAAGACAAAGGGGTTGAAGAAAATTGCAGGGCATAGTTGGATTGAGGTGAAGAAGAA
JMFN009G16+ AGCAAAGACAAAGGGGTTGAAGAAAATTGCAGGGCATAGTTGGATTGAGGTGAAAAAGAA
                      ____________________________________________________________
consensus AGCAAAGACAAAGGGGTTGAAGAAAATTGCAGGGCATAGTTGGATTGAGGTGAAGAAGAA
 
. : . : . : . : . : . :
rJMSF027K15+ GGTGTATATGTTCTCC-CTGGAAAAGCCATGCAGACAGGTATGGAGGAGATACATTGGAT
JMFN009G16+ GGTGTATATGTTCTCCGCTGGAAAAGCCATGCAGACAGGTATGGAGGAGATACATTGGAT
                      ____________________________________________________________
consensus GGTGTATATGTTCTCCGCTGGAAAAGCCATGCAGACAGGTATGGAGGAGATACATTGGAT
 
. : . : . : . : . : . :
rJMSF027K15+ GCTTAATGTTTTGAGTTATCAAATGGAGGAAGAAGATCAAGGTTGCAAAACTGAACAAGA
JMFN009G16+ GCTTAATGTTTTGAGTTATCAAATGGAGGAAGAAGATCAAGGTTGCAAAACTGAACAAGA
                      ____________________________________________________________
consensus GCTTAATGTTTTGAGTTATCAAATGGAGGAAGAAGATCAAGGTTGCAAAACTGAACAAGA
 
. : . : . : . : . : . :
rJMSF027K15+ TTTAGCAAAACAATTGTGAATATTTTTTTAAAATTTTTCTTTAATTCAAGGAGTCAGCAT
JMFN009G16+ TTTAGCAAAACAATTGTGAATATTTTTTTAAAATTTTTCTTTAATTCAAGGAGTCAGCAT
                      ____________________________________________________________
consensus TTTAGCAAAACAATTGTGAATATTTTTTTAAAATTTTTCTTTAATTCAAGGAGTCAGCAT
 
. : . : . : . : . : . :
rJMSF027K15+ AACATTTGATTACAGTAGTAGATATAAGGTCTCTAACACTCAAAGAT
JMFN009G16+ AACATTTGATTACAGTAGTAGATATAAGGTCTCTAACACTCAAAGATGTCATTCTTGATT
rJMFF030C12- TATAAGGTCTCTAACACTCAAAGATGTCATTCTTGATT
                      ____________________________________________________________
consensus AACATTTGATTACAGTAGTAGATATAAGGTCTCTAACACTCAAAGATGTCATTCTTGATT
 
. : . : . : . : . : . :
JMFN009G16+ CTACAATTTGATTTCAAGATAAAATTTGAGC
rJMFF030C12- CTACAATTTGATTTCAAGATAAAATTTGAGCAACTCTCAATCCCATCTCCAGCAGCCATA
                      ____________________________________________________________
consensus CTACAATTTGATTTCAAGATAAAATTTGAGCAACTCTCAATCCCATCTCCAGCAGCCATA
 
. : . : . : . : . : . :
rJMFF030C12- CTTTTACTCATCATTTCAAGATAAAACTGAGCAACTCTCCATTCCATCTCCAGCAAGCAG
                      ____________________________________________________________
consensus CTTTTACTCATCATTTCAAGATAAAACTGAGCAACTCTCCATTCCATCTCCAGCAAGCAG
 
. : . : . : . : . : . :
rJMFF030C12- CATACTTTACTCATCTAGTCTAGTAACAAAAAGTAGACTTCAACCTAGCAACACTAGTAT
                      ____________________________________________________________
consensus CATACTTTACTCATCTAGTCTAGTAACAAAAAGTAGACTTCAACCTAGCAACACTAGTAT
 
. : . : . : . : . : . :
rJMFF030C12- AATTTAAACACGACGACAATGGGCTTCGTAAGGGGCAGATGATGTGGCGAAACGGGGGTA
                      ____________________________________________________________
consensus AATTTAAACACGACGACAATGGGCTTCGTAAGGGGCAGATGATGTGGCGAAACGGGGGTA
 
. : . : . : . : . : . :
rJMFF030C12- GAAAAGTAAATGGGAAACAGACCCTCGACCTCGGTAGAGAATGCCTGACCGTCTGGTCCT
                      ____________________________________________________________
consensus GAAAAGTAAATGGGAAACAGACCCTCGACCTCGGTAGAGAATGCCTGACCGTCTGGTCCT
 
. : . : . : . : . : . :
rJMFF030C12- AGTTACATTTTGCAGCACCCAGCAACCGCGATAATATTTGCAGATGACATGGCGTGAGTG
                      ____________________________________________________________
consensus AGTTACATTTTGCAGCACCCAGCAACCGCGATAATATTTGCAGATGACATGGCGTGAGTG
 
. : . : . : . : . : . :
rJMFF030C12- CAAACTGCAGAACCAGATTTCTCGTGCTGGAAACATCAGTCAGTCCATATCGAGGAACTC
rJMSF016E08- TCAGTCCATATCGAGGAATTC
rJMSF042F24- TCAGTCCATATCGAGGAATTC
rJMSF025L08- TCAGTCCATATCGAGGAATTC
                      ____________________________________________________________
consensus CAAACTGCAGAACCAGATTTCTCGTGCTGGAAACATCAGTCAGTCCATATCGAGGAATTC
 
. : . : . : . : . : . :
rJMFF030C12- CATCCTCTTTCTCATAGTTCCTTTAAGATCGGTAGCCTCTCTTTCTACTTTTTGTGCCCT
rJMSF016E08- CATCCTCTTTCGCATTGTGCCTTTGAGATCCGATGCCTCCCTTTCTGCTTTTTGCGCCCT
rJMSF042F24- CATCCTCTTTCGCATTGTGCCTTTGAGATCCGATGCCTCCCTTTCTGCTTTTTGCGCCCT
rJMSF025L08- CATCCTCTTTCGCATTGTGCCTTTGAGATCCGATGCCTCCCTTTCTGCTTTTTGCGCCCT
                      ____________________________________________________________
consensus CATCCTCTTTCGCATTGTGCCTTTGAGATCCGATGCCTCCCTTTCTGCTTTTTGCGCCCT
 
. : . : . : . : . : . :
rJMFF030C12- TTTTATCTCTGCTTCTGAAACGCGAGTCATATGAGGTGGAAGTTCCTCCTTATCCAAATC
rJMSF016E08- TCGTATCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
rJMSF042F24- TCGTATCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
JMFF030C12+ GAAACGCGAGTCATATGAGGTGGAAGTTCCTCCTTATCCAAATC
rJMSF025L08- TCGTATCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
JMSF042F24+ TCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
JMSF025L08+ ATCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
                      ____________________________________________________________
consensus TCGTATCTCTGGTACTGAAACGCGGGTCATATGTGGCGGAAGTTCGTCCTTATCCAAATC
 
. : . : . : . : . : . :
rJMFF030C12- CAGCTCGCCGATCAGCACAACATTCTCTCCACGAATTATGTATAGACCTAGCGGAATGTC
rJMSF016E08- CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
rJMSF042F24- CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
JMFF030C12+ CAGCTCGCCGATCAGCACAACATTCTCTCCACGAATTATGTATAGACCTAGCGGAATGTC
rJMSF025L08- CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
JMSF042F24+ CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
JMSF025L08+ CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
                      ____________________________________________________________
consensus CAGCTCACCAATCAAGACGACATTTTCTCCACGGATTACATATAATCCTAACGGCATGTC
 
. : . : . : . : . : . :
rJMFF030C12- ACAATAGAGATCACCAACAATAACCCGCTCACATGCACCTTCAAGAACAGCATTTGCAAA
rJMSF016E08- ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
rJMSF042F24- ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
JMFF030C12+ ACAATAGAGATCACCAACAATAACCCGCTCACATGCACCTTCAAGAACAGCATTTGCAAA
rJMSF025L08- ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
JMSF042F24+ ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
JMSF025L08+ ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
                      ____________________________________________________________
consensus ACAATAGATATCACCAACAATAAGACGTTCACAAGCTCCTTCAAGAACAGCATTGGCAAA
 
. : . : . : . : . : . :
rJMFF030C12- TTGGTCAAAAG
rJMSF016E08- TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
rJMSF042F24- TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
JMFF030C12+ TTGGTCAAAAGATCTAAGTGTGACCAAAAGCTTCCGACCATCTCGCAGCAACACAAGAAG
rJMSF025L08- TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
JMSF042F24+ TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
JMSF025L08+ TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
                      ____________________________________________________________
consensus TTGGTCAAAAGAGCGAAGTATCCCCAAAAGCTTTCGACCATCTCGTAACAACACAAGAAT
 
. : . : . : . : . : . :
rJMSF016E08- TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
rJMSF042F24- TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
JMFF030C12+ TTTCTTGTCAAGATAGCTGGCAAGAGAAGTGGAGAGGTGGATATCTTCCGGACTGGCCCA
rJMSF025L08- TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
JMSF042F24+ TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
JMSF025L08+ TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
                      ____________________________________________________________
consensus TTTCTTGTCAAGATAATTGGCAAGAGAGGTAGAGAGATAAATGTCCTCCGCACTAGCCCA
 
. : . : . : . : . : . :
rJMSF016E08- AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
rJMSF042F24- AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
JMFF030C12+ AGACATTATTGATGATAATGA
rJMSF025L08- AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
JMSF042F24+ AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
JMSF025L08+ AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
                      ____________________________________________________________
consensus AGACATTATTGATGATGATGATGAAGGTGAATGGGAGTTGTACGCTCAAAGTAGCTCAGC
 
. : . : . : . : . : . :
rJMSF016E08- TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
rJMSF042F24- TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
rJMSF025L08- TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
JMSF042F24+ TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
JMSF025L08+ TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
JMSF016E08+ CGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
                      ____________________________________________________________
consensus TTTTCCGGTATCAGAAAATTCACCGAAAACTTCTCCAATTTATATCCAAATTGCATTGGC
 
. : . : . : . : . : . :
rJMSF016E08- AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTT
rJMSF042F24- AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAANTCTTGNAA
rJMSF025L08- AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTTGAAA
JMSF042F24+ AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTTGAAA
JMSF025L08+ AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTTGAAA
JMSF016E08+ AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTTGAAA
                      ____________________________________________________________
consensus AGCTCGGATTACCCTCGGCTTATATTGCTCCCCAAAACCCCAGTTCTTGAA-TCTTGAAA
 
. : . : . : . : . : . :
rJMSF042F24- AAGTCC
rJMSF025L08- AAGTCCAATGCTAAA
JMSF042F24+ AAGTCCAATGCTAAAACCCAAACGGAAAAAGGGTTGGAGGGAGAAACTTGCTGACTTTTG
JMSF025L08+ AAGTCCAATGCTAAAACCCAAACGGAAAAAGGGTTGAAGGGAGAAACTTGCTGACTTTTG
JMSF016E08+ AAGTCCAATGCTAAAACCCAAACGGAAAAAGGGTTGGAGGGAGAAACTTGCTGACTTTTG
                      ____________________________________________________________
consensus AAGTCCAATGCTAAAACCCAAACGGAAAAAGGGTTGGAGGGAGAAACTTGCTGACTTTTG
 
. : . : . : . : . : . :
JMSF042F24+ CGCTTTGATTCAGATCTGGGAAAACCCTAACTACCGTTGTGACGCACGGAGCCACGGAGT
JMSF025L08+ CGCTTTGATTCAGATCTGGGAAAACCCTAACTACCGTTGTGACGCACGGAGCCACGGAGT
JMSF016E08+ CGCTTTGATTCAGATCTGGGAAAACCCTAACTACCGTTGTGACGCACGGAGCCACGGAGT
                      ____________________________________________________________
consensus CGCTTTGATTCAGATCTGGGAAAACCCTAACTACCGTTGTGACGCACGGAGCCACGGAGT
 
. : . : . : . : . : . :
JMSF042F24+ ATTTACTACAGAAATCTGGCGAGAGAGAAATAGAAGGCCAAGCTTCCCCTAGCACTTCTC
JMSF025L08+ ATTTACTACAGAAATCTGGCGAGAGAGAAATAGAAGGCCAAGCTTCCCCTAGCACTTCTC
JMSF016E08+ ATTTACTACAGAAATCTGGCGAGAGAGAAATAGAAGGCCAAGCTTCCCCTAGCACTTCTC
                      ____________________________________________________________
consensus ATTTACTACAGAAATCTGGCGAGAGAGAAATAGAAGGCCAAGCTTCCCCTAGCACTTCTC