Previous Contig 005600:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012I05Sequence327005600 (10)282013064 (3)gb:AY142683_15830990.008Arabidopsis thaliana unknown protein (At4g01300) mRNA, complete cds.
JMFS019G09Sequence497005600 (10)
JMFS050H12Sequence569005600 (10)pir|T01714|T017142e-32hypothetical protein A_IG002N01.4 - Arabidopsis thaliana>gb:IG002N01_1683036 Ara
JMFS064G08Sequence609005600 (10)pir|T01714|T017147e-26hypothetical protein A_IG002N01.4 - Arabidopsis thaliana>gb:IG002N01_1683036 Ara
JMFS079G06Sequence627005600 (10)
JMFS124B11Sequence576005600 (10)
JMSF016C16Sequence461005600 (10)725005600 (10)
JMSF030P23Sequence615005600 (10)626005600 (10)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS050H12+ GGTCCTGCCTT
                      ____________________________________________________________
consensus GGTCCTGCCTT
 
. : . : . : . : . : . :
JMFS050H12+ GTAAGGGCGGGGAGGATGATAAGGCTCATTGCTCTTGCTAAGTTGATAATGATCATTTCC
                      ____________________________________________________________
consensus GTAAGGGCGGGGAGGATGATAAGGCTCATTGCTCTTGCTAAGTTGATAATGATCATTTCC
 
. : . : . : . : . : . :
JMFS050H12+ CCGCGTTTTTGACGCAGGTATTCCAGACGCATATACAGATGGTCTTGGAAATGAACCGCT
JMFS064G08+ TTTGACGCAGGTATTCCAGACGCATATACAGATGGTCTTGGAAATGAACCGCT
                      ____________________________________________________________
consensus CCGCGTTTTTGACGCAGGTATTCCAGACGCATATACAGATGGTCTTGGAAATGAACCGCT
 
. : . : . : . : . : . :
JMFS050H12+ TCCAAGAAGTCCATCATGCTCAGGAGTCTGCCAAGACCGCCGGGGTTGATTTCCATGGCG
JMFS064G08+ TCCAAGAAGTCCATCATGCTCAGGAGTCTGCCAAGACCGCCGGGGTTGATTTCCATGGCG
                      ____________________________________________________________
consensus TCCAAGAAGTCCATCATGCTCAGGAGTCTGCCAAGACCGCCGGGGTTGATTTCCATGGCG
 
. : . : . : . : . : . :
JMFS050H12+ CTTAACAGATTCTGAATCCCGAGCAGATTGTGTATCGCTTTCCAGATCACTTCGTGCAGA
JMFS064G08+ CCTAACAGATTCTGAATCCCGAGCAGATTGTGTATCGCTTTCCAGATCACTTCGTGCAGA
                      ____________________________________________________________
consensus CTTAACAGATTCTGAATCCCGAGCAGATTGTGTATCGCTTTCCAGATCACTTCGTGCAGA
 
. : . : . : . : . : . :
JMFS050H12+ GAAACGGTTTTCCCATCTTCCATAAATCACTCTAGTAGGAGGAGATGAACCATAATCATT
JMFS064G08+ GAAACGGTTTTCCCATCTTCCATAAATCACTCTAGTAGGAGGAGATGAACCATAATCATT
                      ____________________________________________________________
consensus GAAACGGTTTTCCCATCTTCCATAAATCACTCTAGTAGGAGGAGATGAACCATAATCATT
 
. : . : . : . : . : . :
JMFS050H12+ GCGTCTGAAGCCTTGTAAAGGAGGCGCAGCAGCAGAGATTCTTTGGCGATCTGGTTCGTC
JMFS064G08+ GCGTCTGAAGCCTTGTAAAGGAGGCGCAGCAGCAGAGATTCTTTGGCGATCTGGTTCGTC
                      ____________________________________________________________
consensus GCGTCTGAAGCCTTGTAAAGGAGGCGCAGCAGCAGAGATTCTTTGGCGATCTGGTTCGTC
 
. : . : . : . : . : . :
JMFS050H12+ ATATGGAGTACTATCGAGCTCACTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
JMFF012I05+ CTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
JMFS064G08+ ATATGGAGTACTATCGAGCTCACTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
rJMSF030P23- CTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
rJMSF016C16- CTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
                      ____________________________________________________________
consensus ATATGGAGTACTATCGAGCTCACTCGGAAGTGCTGGCTCAATCCCACTTGGTAGCTTCTT
 
. : . : . : . : . : . :
JMFS050H12+ ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGAATAAGATA
JMFF012I05+ ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGTATAAGATATTTTTGAATG
JMFS064G08+ ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGTATAAGATATTTTTGAATG
rJMSF030P23- ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGTATAAGATATTTTTGAATG
rJMSF016C16- ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGTATAAGATATTTTTGAATG
                      ____________________________________________________________
consensus ACATATCTCCAATTCACTCAAGGACAAAAGGAACTCCCGTGTATAAGATATTTTTGAATG
 
. : . : . : . : . : . :
JMFF012I05+ CTTCTGGCTATGTATACTGGAGGATTCTTCTGGGAGACTTGGATCTTCATTATCTAAGCT
JMFS064G08+ CTTCTGGCTATGTATACTGGAGGATTCTTCTGGGAGACTTGGATCTTCATTATCTAAGCT
rJMSF030P23- CTTCTGGCTATGTATACTGGAGGATTCTTCTGGGAGACTTGGATCTTCATTATCTAAGCT
rJMSF016C16- CTTCTGGCTATGTATACTGGAGGATTCTTCTGGGAGACTTGGATCTTCATTATCTAAGCT
                      ____________________________________________________________
consensus CTTCTGGCTATGTATACTGGAGGATTCTTCTGGGAGACTTGGATCTTCATTATCTAAGCT
 
. : . : . : . : . : . :
JMFF012I05+ CATTCTGAGAGATTTGAGATTACTTTCCAGAACCAGCTAATACAAG
JMFS064G08+ CATTCTGAGAGATTTGAGATTACTTTCCAGAACCAGCTAATACAAGCAGACCCCTGAACT
rJMSF030P23- CATTCTGAGAGATTTGAGATTACTTTCCAGAACCAGCTAATACAAGCAGACCCCTGAACT
rJMSF016C16- CATTCTGAGAGATTTGAGATTACTTTCCAGAACCAGCTAATACAAGCAGACCCCTGAACT
                      ____________________________________________________________
consensus CATTCTGAGAGATTTGAGATTACTTTCCAGAACCAGCTAATACAAGCAGACCCCTGAACT
 
. : . : . : . : . : . :
JMFS064G08+ GATAATTGTCCACCACTACCAACAATCTATCTACTCGTATTCATTACCAAAAAACATCAT
rJMSF030P23- GATAATTGTCCACCACTACCAACAATCTATCTACTCGTATTCATTACCAAAAAACATCAT
rJMSF016C16- GATAATTGTCCACCACTACCAACAATCTATCTACTCGTATTCATTACCAAAAAACATCAT
                      ____________________________________________________________
consensus GATAATTGTCCACCACTACCAACAATCTATCTACTCGTATTCATTACCAAAAAACATCAT
 
. : . : . : . : . : . :
JMFS064G08+ CTCTTAGTCATAGCAA
rJMSF030P23- CTCTTAGTCATAGCAAGCAATATTATCCCGGAAATCCCTAATTAACCCCTGGAGATACAA
rJMSF016C16- CTCTTAGTCATAGCAAGCAATATTATCCCGGAAATCCCTAATTAACCCCTGGAGATACAA
                      ____________________________________________________________
consensus CTCTTAGTCATAGCAAGCAATATTATCCCGGAAATCCCTAATTAACCCCTGGAGATACAA
 
. : . : . : . : . : . :
rJMSF030P23- ATAAACAATATTTTCACGGAATCGTACCCAAAGGCAATTATGTAACGTCAAATTCCAGTC
rJMSF016C16- ATAAACAATATTTTCACGGAATCGTACCCAAAGGCAATTATGTAACGTCAAATTCCAGTC
JMFS124B11+ AACGTCAAATTCCAGTC
JMFS079G06+ GAATCGTACCCAAAGGCAATTATGTAACGTCAAATTCCAGTC
                      ____________________________________________________________
consensus ATAAACAATATTTTCACGGAATCGTACCCAAAGGCAATTATGTAACGTCAAATTCCAGTC
 
. : . : . : . : . : . :
rJMSF030P23- ACCGGCTCGTTAGTTCATACTACGACCGCCATTGAAAACAACAGAATACGAATGATATAA
rJMSF016C16- ACCGGCTCGTTAGTTCATACTACGACCGCCATTGAAAACAACAGAATACGAATGATATAA
JMFS124B11+ ACCGGCTCGTTAGTTCATACTACGACCGCCATTGAAAACAACAGAATACGAATGATATAA
JMFS079G06+ ACCGGCTCGTTAGTTCATACTACGACCGCCATTGAAAACAACAGAATACGAATGATATAA
                      ____________________________________________________________
consensus ACCGGCTCGTTAGTTCATACTACGACCGCCATTGAAAACAACAGAATACGAATGATATAA
 
. : . : . : . : . : . :
rJMSF030P23- TAGCGCAAAAGCAATAGCAAAGCTACAGATTTCGAATAAACCTAATCCACTTGATCGAGC
rJMSF016C16- TAGCGCAAAAGCAATAGCAAAGCTACAGATTTCGAATAAACCTAATCCACTTGATCGAGC
JMFS124B11+ TAGCGCAAAAGCAATAGCAAAGCTACAGATTTCGAATAAACCTAATCCACTTGATCGAGC
JMFS019G09+ AGCAAAGGTACAGGTTTGGAATAAACGTAATCCCCTTGATCGAGC
JMFS079G06+ TAGCGCAAAAGCAATAGCAAAGCTACAGATTTCGAATAAACCTAATCCACTTGATCGAGC
JMSF030P23+ TCCACTTGATCGAGC
                      ____________________________________________________________
consensus TAGCGCAAAAGCAATAGCAAAGCTACAGATTTCGAATAAACCTAATCCACTTGATCGAGC
 
. : . : . : . : . : . :
rJMSF030P23- TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTC
rJMSF016C16- TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTCCACTC
JMFS124B11+ TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTCCACTC
JMFS019G09+ TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTCCACTC
JMFS079G06+ TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTCCACTC
JMSF030P23+ TCAATCTACAAGGAAATCGCGAAAACCATACCCAATACTCAATCAATCCTAGCTCCACTC
                      ____________________________________________________________
consensus TCAATCTACAAGGAAATCGCGAAAACCATA-CCAATACTCAATCAATCCTAGCTCCACTC
 
. : . : . : . : . : . :
rJMSF016C16- CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
JMFS124B11+ CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
JMFS019G09+ CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
JMFS079G06+ CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
JMSF030P23+ CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
                      ____________________________________________________________
consensus CATAAAAAATATCATTCACAACGACATTCATCGAAATCCGACCTCAAACATACGCATCCT
 
. : . : . : . : . : . :
rJMSF016C16- TACGATGATCTCGAATTCAACAATAACGTTTACG
JMFS124B11+ TACGATGATCTCGAATTCAACAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
JMFS019G09+ TACGATGATCTCGAATTCAGCAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
JMFS079G06+ TACGATGATCTCGAATTCAACAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
JMSF030P23+ TACGATGATCTCGAATTCAACAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
JMSF016C16+ ACAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
                      ____________________________________________________________
consensus TACGATGATCTCGAATTCAACAATAACGTTTACGAAATCTGAAACCACAAACTCAACCTT
 
. : . : . : . : . : . :
JMFS124B11+ CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
JMFS019G09+ CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
JMFS079G06+ CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
JMSF030P23+ CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
JMSF016C16+ CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
                      ____________________________________________________________
consensus CAACAACACCCGTGCAAGAGGAAATTCGTAGGTTTTCTTTCCTATTTCTCTCGTAATCTG
 
. : . : . : . : . : . :
JMFS124B11+ ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAAGATACAGAAAAGAG
JMFS019G09+ ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAACATACAGAAAAGAG
JMFS079G06+ ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAAGATACAGAAAAGAG
JMSF030P23+ ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAAGATACAGAAAAGAG
JMSF016C16+ ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAAGATACAGAAAAGAG
                      ____________________________________________________________
consensus ATCTTAACGATTTCAACGCTAGGGTTTACTTTTCTATCTGGATCAAGATACAGAAAAGAG
 
. : . : . : . : . : . :
JMFS124B11+ AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
JMFS019G09+ AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
JMFS079G06+ AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
JMSF030P23+ AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
JMSF016C16+ AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
                      ____________________________________________________________
consensus AGAGAGTTAGGGCTTCGATGTTCGCAAATTTCCCCACTTCTCCAACTGAATCGCAAGACC
 
. : . : . : . : . : . :
JMFS124B11+ TGAGAGAACAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
JMFS019G09+ TGAGAGAGCAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
JMFS079G06+ TGAGAGAACAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
JMSF030P23+ TGAGAGAACAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
JMSF016C16+ TGAGAGAACAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
                      ____________________________________________________________
consensus TGAGAGAACAATACAGAGACATATATGGACGTGTATATATATATTATATATAGAGAGAGA
 
. : . : . : . : . : . :
JMFS124B11+ GAGAACGAAAGAGAGAAAGA
JMFS019G09+ GAGAACGAAAGAGAGAAAGAGAGGTTCGGTTCC
JMFS079G06+ GAGAACGAAAGAGAGAAAGAGAGGTTCGGTTCCGCGGCGGAGGGGA
JMSF030P23+ GAGAACGAAAGAGAGAAAGAGAGGTTCGGTTCCGCGGCGGAGGGGAGGGGTCCGGAGTCT
JMSF016C16+ GAGAACGAAAGAGAGAAAGAGAGGTTCGGTTCCGCGGCGGAGGGGAGGGGTCCGGAGTCT
                      ____________________________________________________________
consensus GAGAACGAAAGAGAGAAAGAGAGGTTCGGTTCCGCGGCGGAGGGGAGGGGTCCGGAGTCT
 
. : . : . : . : . : . :
JMSF030P23+ GTAAGGGGTGATTGAGGAGGAAAGCCAAAGAAATGACGTTGGCTACGCTGCACGGCCGGG
JMSF016C16+ GTAAGGGGTGATTGAGGAGGAAAGCCAAAGAAATGACGTTGGCTACGCTGCACGGCCGGG
                      ____________________________________________________________
consensus GTAAGGGGTGATTGAGGAGGAAAGCCAAAGAAATGACGTTGGCTACGCTGCACGGCCGGG
 
. : . : . : . : . : . :
JMSF030P23+ AAAACTATACTCCGCAATCAATTCACGCGCTGTCTCCATTGCGTGATTCTTGGGC
JMSF016C16+ AAAACTATACTCCGCAATCAATTCACGCGCTGTCTCCATTGCGTGATTCTTGGGCCCTCC
                      ____________________________________________________________
consensus AAAACTATACTCCGCAATCAATTCACGCGCTGTCTCCATTGCGTGATTCTTGGGCCCTCC