Previous Contig 005597:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS110E06Sequence626005597 (5)sp|Q39054|CNX1_ARATH1e-52Molybdopterin biosynthesis CNX1 protein (Molybdenum cofactor biosynthesis enzyme
JMSF016B24Sequence232005597 (5)gb:ATH236870_15520541e-11Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal749011867 (4)gb:ATH236870_15520543e-85Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal
JMSF017J03Sequence244005597 (5)gb:ATH236870_15520547e-18Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal791011867 (4)gb:ATH236870_15520542e-47Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal
JMSF042E16Sequence781005597 (5)sp|Q39054|CNX1_ARATH1e-97Molybdopterin biosynthesis CNX1 protein (Molybdenum cofactor biosynthesis enzyme781011867 (4)gb:ATH236870_15520542e-87Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal
JMSF047N10Sequence663005597 (5)sp|Q39054|CNX1_ARATH6e-77Molybdopterin biosynthesis CNX1 protein (Molybdenum cofactor biosynthesis enzyme744011867 (4)gb:ATH236870_15520542e-83Arabidopsis thaliana cnx1 gene, exons 1-13.>gb:ATHCNX1R_1553113 Arabidopsis thal

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042E16+ AACACCT
                      ____________________________________________________________
consensus AACACCT
 
. : . : . : . : . : . :
JMSF042E16+ CCAGAGGTTAGAAGGATATTGATTCCAGAAGAGAAGGCGCTGTCTAAGGTTTTTTCAATC
                      ____________________________________________________________
consensus CCAGAGGTTAGAAGGATATTGATTCCAGAAGAGAAGGCGCTGTCTAAGGTTTTTTCAATC
 
. : . : . : . : . : . :
JMSF042E16+ TGGCATTCATCATCACCAACTATACCAAGATCAATAACTCTGCAGTGCTGGTCTGTTGCA
                      ____________________________________________________________
consensus TGGCATTCATCATCACCAACTATACCAAGATCAATAACTCTGCAGTGCTGGTCTGTTGCA
 
. : . : . : . : . : . :
JMSF042E16+ GCAGCAAGGATCATTGCACGATTGGAGTCCCTTATCTGACCCCGGGATAAGCATCCAACT
                      ____________________________________________________________
consensus GCAGCAAGGATCATTGCACGATTGGAGTCCCTTATCTGACCCCGGGATAAGCATCCAACT
 
. : . : . : . : . : . :
JMSF042E16+ TCTGGCTCTACAAGCTCATCACCTGTGGAGAGGACAGCAATTGTAGGGGTAGGATACACC
                      ____________________________________________________________
consensus TCTGGCTCTACAAGCTCATCACCTGTGGAGAGGACAGCAATTGTAGGGGTAGGATACACC
 
. : . : . : . : . : . :
JMSF042E16+ TGCACTATAGTCACCCCAACTGTGGCAAGTAAACCGATTTCTGGAGCCCCTAAATGCTCC
                      ____________________________________________________________
consensus TGCACTATAGTCACCCCAACTGTGGCAAGTAAACCGATTTCTGGAGCCCCTAAATGCTCC
 
. : . : . : . : . : . :
JMSF042E16+ CCGGATTTCAATACTACATCACCCTTTGCAATATCAGACCCCACCGGACGAATATCAACT
JMFS110E06+ CCACCGGACGAATATCAACT
JMSF047N10+ CCACCGGACGAATATCAACT
                      ____________________________________________________________
consensus CCGGATTTCAATACTACATCACCCTTTGCAATATCAGACCCCACCGGACGAATATCAACT
 
. : . : . : . : . : . :
JMSF042E16+ CCTGGGCCAGTTCCCTTCAAAATCCGTACTTGCTTTGATTCATTTGAAGCATCTAACAAC
JMFS110E06+ CCTGGGCCAGTTCCCTTCAAAATCCGTACTTGCTTTGATTCATTTGAAGCATCTAACAAC
JMSF047N10+ CCTGGGCCAGTTCCCTTCAAAATCCGTACTTGCTTTGATTCATTTGAAGCATCTAACAAC
                      ____________________________________________________________
consensus CCTGGGCCAGTTCCCTTCAAAATCCGTACTTGCTTTGATTCATTTGAAGCATCTAACAAC
 
. : . : . : . : . : . :
JMSF042E16+ AATTCAGTGTTCTCTACTTGCACAACAGCATCAGCACCATCAGGTATTGGTCCTCCAGTT
JMFS110E06+ AATTCAGTGTTCTCTACTTGCACAACAGCATCAGCACCATCAGGTATTGGTCCTCCAGTT
JMSF047N10+ AATTCAGTGTTCTCTACTTGCACAACAGCATCAGCACCATCAGGTATTGGTCCTCCAGTT
                      ____________________________________________________________
consensus AATTCAGTGTTCTCTACTTGCACAACAGCATCAGCACCATCAGGTATTGGTCCTCCAGTT
 
. : . : . : . : . : . :
JMSF042E16+ GTTACATATGCAACAGTTCCAGGAGTCACAACCACACCAAGTCCATCATTTCCTGCTCTT
JMFS110E06+ GTTACATATGCAACAGTTCCAGGAGTCACAACCACACCAAGTCCATCATTTCCTGCTCTT
JMSF047N10+ GTTACATATGCAACAGTTCCAGGAGTCACAACCACACCAAGTCCATCATTTCCTGCTCTT
                      ____________________________________________________________
consensus GTTACATATGCAACAGTTCCAGGAGTCACAACCACACCAAGTCCATCATTTCCTGCTCTT
 
. : . : . : . : . : . :
JMSF042E16+ GACTCAGTGATTATAGGATACACACCTGGTCCATCAGAAGAAACAACTGCATATCCATCC
JMFS110E06+ GACTCAGTGATTATAGGATACACACCTGGTCCATCAGAAGAAACAACTGCATATCCATCC
JMSF047N10+ GACTCAGTGATTATAGGATACACACCTGGTCCATCAGAAGAAACAACTGCATATCCATCC
JMSF017J03+ ATCAGAAGAAACANCTGCATATCCATCC
                      ____________________________________________________________
consensus GACTCAGTGATTATAGGATACACACCTGGTCCATCAGAAGAAACAACTGCATATCCATCC
 
. : . : . : . : . : . :
JMSF042E16+ TTGATAGAGGCAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
JMFS110E06+ TTGATAGAGGCAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
JMSF047N10+ TTGATAGAGGCAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
JMSF017J03+ TTGATAGAGGCAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
JMSF016B24+ CAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
                      ____________________________________________________________
consensus TTGATAGAGGCAGGGTAAGGAGGAAGAGGGTCGGGAGCAGTAATATCTTCGGCCAATACT
 
. : . : . : . : . : . :
JMSF042E16+ CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
JMFS110E06+ CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
JMSF047N10+ CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
JMSF017J03+ CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
JMSF016B24+ CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
                      ____________________________________________________________
consensus CTGCCTAGAGCCTGGTGGAGCGGCACGCTGACCGGCGGCAGGCGCTGAGCAACGCTCAGC
 
. : . : . : . : . : . :
JMSF042E16+ ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCC
JMFS110E06+ ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCCATTTTCA
JMSF047N10+ ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCCATTTTCA
JMSF017J03+ ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCCATTTTCA
JMSF016B24+ ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCCATTTTCA
                      ____________________________________________________________
consensus ACTATCTCAAGGGCTTCATTCGAAGATACCATCTTAGAGATTGGGGCTTCGCCATTTTCA
 
. : . : . : . : . : . :
JMFS110E06+ CTC
JMSF047N10+ CTCATTCTCAGCTTCGCTGTTTTGACTTCGT
JMSF017J03+ CTCATTCTCAGCTTCGCTGTTTTGACTTCGT
JMSF016B24+ CTCATTCTCAGCTTCGCTGTTTTGACTTCGTTACTATCTCGTTCTGGTAGTAGTAGGCTC
                      ____________________________________________________________
consensus CTCATTCTCAGCTTCGCTGTTTTGACTTCGTTACTATCTCGTTCTGGTAGTAGTAGGCTC