Previous Contig 005591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016A10Sequence242005591 (2)770011862 (2)gb:AY062478_15651341e-43Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds.>gb:AY093262
JMSF050F12Sequence733005591 (2)gb:AY062478_15651345e-62Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds.>gb:AY093262732011862 (2)gb:AY062478_15651343e-39Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds.>gb:AY093262

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050F12+ CTGCAAATGGTACG
                      ____________________________________________________________
consensus CTGCAAATGGTACG
 
. : . : . : . : . : . :
JMSF050F12+ AACAGCATGGGTAATGCCCTGATAATACATGGCACTCCTCTGTGCTGCCAACCTTGTCCT
                      ____________________________________________________________
consensus AACAGCATGGGTAATGCCCTGATAATACATGGCACTCCTCTGTGCTGCCAACCTTGTCCT
 
. : . : . : . : . : . :
JMSF050F12+ AACAAGATCCAATGGGTAGGTGGCAGAAGCAGCTGTCATTCCAGCTAACCCACCACCTAC
                      ____________________________________________________________
consensus AACAAGATCCAATGGGTAGGTGGCAGAAGCAGCTGTCATTCCAGCTAACCCACCACCTAC
 
. : . : . : . : . : . :
JMSF050F12+ AAAATGCACAAATACATCTGCACTCGCATTTCCCTGATTACCATCCAGGCCAGGAATAGA
                      ____________________________________________________________
consensus AAAATGCACAAATACATCTGCACTCGCATTTCCCTGATTACCATCCAGGCCAGGAATAGA
 
. : . : . : . : . : . :
JMSF050F12+ TTTCAAGATTTTCTTGTAGTATTCATAAGTATAAAAATTGACTGAAGAATAGGGGAGCCT
                      ____________________________________________________________
consensus TTTCAAGATTTTCTTGTAGTATTCATAAGTATAAAAATTGACTGAAGAATAGGGGAGCCT
 
. : . : . : . : . : . :
JMSF050F12+ ATGAGCAATAGTGACAAGGTTTCCCTTCCAAAATGCTCTGAATCCTTCTTCATTAACAAT
                      ____________________________________________________________
consensus ATGAGCAATAGTGACAAGGTTTCCCTTCCAAAATGCTCTGAATCCTTCTTCATTAACAAT
 
. : . : . : . : . : . :
JMSF050F12+ CCGCAAAGTCTCACGGCATATACTTGGCTTGCTCAACACTGCTACGTCTGAATGCATGCC
                      ____________________________________________________________
consensus CCGCAAAGTCTCACGGCATATACTTGGCTTGCTCAACACTGCTACGTCTGAATGCATGCC
 
. : . : . : . : . : . :
JMSF050F12+ TTGGACCTGAAATAGAATGGTGAGGCGAGCTAGAGGAGCAGTACAGGTCTTGCTGAAAGC
                      ____________________________________________________________
consensus TTGGACCTGAAATAGAATGGTGAGGCGAGCTAGAGGAGCAGTACAGGTCTTGCTGAAAGC
 
. : . : . : . : . : . :
JMSF050F12+ TCCGGCAATACCGCCGGCGAGAAGCTGCGGCACAGTCCCAATTTGCGTCTGCGGATTCTG
JMSF016A10+ TG
                      ____________________________________________________________
consensus TCCGGCAATACCGCCGGCGAGAAGCTGCGGCACAGTCCCAATTTGCGTCTGCGGATTCTG
 
. : . : . : . : . : . :
JMSF050F12+ AGGCTGCTGTTGCTGCTGCGTGTGGAAGTGATGATATTTCTGACGCTGGTGGTGGTGCTG
JMSF016A10+ AGGCTGCTGTTGCTGCTGCGTGTGGAAGTGATGATATTTCTGACGCTGGTGGTGGTGCTG
                      ____________________________________________________________
consensus AGGCTGCTGTTGCTGCTGCGTGTGGAAGTGATGATATTTCTGACGCTGGTGGTGGTGCTG
 
. : . : . : . : . : . :
JMSF050F12+ CGGCAGAAACGACCCGGGGCCGCCGTCAACTACGGCGCCGCCGCGACCAGACATTCCTAC
JMSF016A10+ CGGCAGAAACGACCCGGGGCCGCCGTCAACTACGGCGCCGCCGCGACCAGACATTCCTAC
                      ____________________________________________________________
consensus CGGCAGAAACGACCCGGGGCCGCCGTCAACTACGGCGCCGCCGCGACCAGACATTCCTAC
 
. : . : . : . : . : . :
JMSF050F12+ TCTGGCTTCCATCGTCTTTTTGCACTATAAAATTTGAAAATTTGTAGAAACTTCACATTT
JMSF016A10+ TCTGGCTTCCATCGTCTTTTTGCACTATAAAATTTGAAAATTTGTAGAAACTTCACATTT
                      ____________________________________________________________
consensus TCTGGCTTCCATCGTCTTTTTGCACTATAAAATTTGAAAATTTGTAGAAACTTCACATTT
 
. : . : . : . : . : . :
JMSF050F12+ GATCTTCGCTGAGAATTTCGTTTCCGGGTGCAGGGAAGTTAAACCCTAGGGAAAACCC
JMSF016A10+ GATCTTCGCTGAGAATTTCGTTTCCGGGTGCAGGGAAGTTAAACCCTAGGGAAAACCCTC
                      ____________________________________________________________
consensus GATCTTCGCTGAGAATTTCGTTTCCGGGTGCAGGGAAGTTAAACCCTAGGGAAAACCCTC