Previous Contig 005564:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003E13Sequence482005564 (29)gb:AB035183_15189262e-48Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd771005564 (29)gb:AB035183_1518926e-120Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF018K14Sequence457005564 (29)gb:AB035183_15189261e-44Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd719005564 (29)gb:AB035183_1518926e-108Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF023A18Sequence484005564 (29)gb:AB035183_15189266e-40Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd688005564 (29)gb:AB035183_15189265e-72Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF023H21Sequence457005564 (29)gb:AB035183_15189262e-45Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd692005564 (29)gb:AB035183_1518926e-103Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF029O21Sequence533005564 (29)gb:AB035183_15189263e-52Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd658005564 (29)gb:AB035183_15189261e-92Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF043G08Sequence625005564 (29)gb:AB035183_15189266e-76Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd620005564 (29)gb:AB035183_15189261e-74Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFF051G09Sequence605005564 (29)gb:AB035183_15189265e-75Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd564005564 (29)gb:AB035183_15189263e-74Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFN019M07Sequence641005564 (29)gb:AB035183_1518926e-116Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMFS050G02Sequence606005564 (29)gb:AB035183_15189266e-62Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF013C02Sequence443014022 (7)gb:AY096642_15761803e-30Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672782005564 (29)gb:AB035183_1518926e-122Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF015J24Sequence357005564 (29)gb:AB035183_15189262e-26Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd701005564 (29)gb:AB035183_1518926e-108Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF016J24Sequence427005564 (29)gb:AB035183_15189264e-39Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd774005564 (29)gb:AB035183_1518926e-121Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF023L10Sequence681005564 (29)gb:AB035183_15189261e-88Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd753005564 (29)gb:AB035183_15189262e-92Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF027D10Sequence699005564 (29)gb:AB035183_15189267e-92Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd776005564 (29)gb:AB035183_1518926e-121Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF043I07Sequence770005564 (29)gb:AB035183_1518926e-107Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd791005564 (29)gb:AB035183_1518926e-122Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF050E16Sequence681005564 (29)gb:AB035183_15189261e-88Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd769005564 (29)gb:AB035183_1518926e-122Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023A18- GTCTTTAACAAAGTTTACCAACTACACA
                      ____________________________________________________________
consensus GTCTTTAACAAAGTTTACCAACTACACA
 
. : . : . : . : . : . :
rJMFF023A18- TCTATACACCCTCGAGTAGTGATTACAGGTTCTTCTCGTCACTCAAACGATGGAAAGCAA
rJMSF023L10- CACCCTCGAGTAGTGATTACAGGTTTTTCTCGTCACTCAAACGATGGAAAGCAA
                      ____________________________________________________________
consensus TCTATACACCCTCGAGTAGTGATTACAGGTTTTTCTCGTCACTCAAACGATGGAAAGCAA
 
. : . : . : . : . : . :
rJMFF023A18- ATCATAATGATTTTTTCCAAAAGCAACTAGGAAGAACATGTATTTATTGCAAAAGGGTGG
rJMFF051G09- TATTGCAAAAGGGTGG
rJMFF029O21- TGTATTTATTGCAAAAGGGTGG
rJMFF043G08- TAGGAAGAACATGTATTTATTGCAAAAGGGTGG
rJMSF023L10- ATCATAATGATTTTTTCCAAAAGCAACTAGGAAGAACATGTATTTATTGCAAAAGGGTGG
rJMFF023H21- GGGTGG
rJMFF018K14- GGGTGG
                      ____________________________________________________________
consensus ATCATAATGATTTTTTCCAAAAGCAACTAGGAAGAACATGTATTTATTGCAAAAGGGTGG
 
. : . : . : . : . : . :
rJMFF023A18- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF051G09- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF029O21- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF043G08- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF023L10- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF023H21- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF018K14- ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF043I07- GAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF027D10- AAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF016J24- AAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF050E16- AATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMFF003E13- AATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF015J24- AAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
rJMSF013C02- AAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
                      ____________________________________________________________
consensus ATTGAGATTTGAAAAAGCTACAATTTTTAGGTAAGGGGAAAATATTACACCAAGCCTCAT
 
. : . : . : . : . : . :
rJMFF023A18- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMFF051G09- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGCCACAACAGTTAAAACCATTGCCTCC
rJMFF029O21- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMFF043G08- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF023L10- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMFF023H21- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMFF018K14- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF043I07- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF027D10- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF016J24- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF050E16- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMFF003E13- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF015J24- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
rJMSF013C02- TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
                      ____________________________________________________________
consensus TCCAGAATTGCAGTCAAACCCAGAATTGATTCAGTCACAACAGTTAAAACCATTGCCTCC
 
. : . : . : . : . : . :
rJMFF023A18- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF051G09- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF029O21- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF043G08- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF023L10- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF023H21- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF018K14- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF043I07- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF027D10- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF016J24- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF050E16- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMFF003E13- AGTTTTCATGGCTCCTTCAGAAACCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF015J24- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
rJMSF013C02- AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
                      ____________________________________________________________
consensus AGTTTTCATGGCTCCTTCAGAAATCATACAAGAACTCCTTGAAGAGTGGCATGTGTTCAG
 
. : . : . : . : . : . :
rJMFF023A18- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAACATAGA
rJMFF051G09- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMFF029O21- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMFF043G08- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF023L10- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMFF023H21- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMFF018K14- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF043I07- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF027D10- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF016J24- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF050E16- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMFF003E13- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF015J24- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
rJMSF013C02- CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
                      ____________________________________________________________
consensus CATCCAAACAGACAGCCAAGGATAGTGTCCTATCCTTGTTTGGGCTGGGGAGAATATAGA
 
. : . : . : . : . : . :
rJMFF023A18- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF051G09- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF029O21- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF043G08- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF023L10- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF023H21- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF018K14- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF043I07- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF027D10- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF016J24- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF050E16- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMFF003E13- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF015J24- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
rJMSF013C02- CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
                      ____________________________________________________________
consensus CTGTGCCTTCATACAGAATACAGGCAGGTCCCATGTGGATAGGCCTTCCCCACCCGAAAT
 
. : . : . : . : . : . :
rJMFF023A18- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF051G09- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF029O21- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF043G08- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMSF023L10- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF023H21- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF018K14- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMSF043I07- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMSF027D10- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMSF016J24- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAAGTTGGGGCTAGCAAAGT
rJMSF050E16- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMFF003E13- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
rJMSF015J24- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAAGTTGGGGCTAGCAAAGT
rJMSF013C02- CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
JMFN019M07+ TTAAGGTTGGGGCTAGCAAAGT
                      ____________________________________________________________
consensus CGGATTCGTGAACTGGCAACCTAGTCCAGCTGTTGATGTTAAGGTTGGGGCTAGCAAAGT
 
. : . : . : . : . : . :
rJMFF023A18- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF051G09- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF029O21- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF043G08- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF023L10- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF023H21- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF018K14- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF043I07- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF027D10- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF016J24- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF050E16- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMFF003E13- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF015J24- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
rJMSF013C02- AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
JMFN019M07+ AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
                      ____________________________________________________________
consensus AGTTTGATCCTCGGATGAGTTTCGATAGGTCTGGTTGGCATTCCAGGAAGTCGAGGGCTG
 
. : . : . : . : . : . :
rJMFF023A18- ACCTTAGGTACTCGTCGTCCATTCTTGAAAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF051G09- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF029O21- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF043G08- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF023L10- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF023H21- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF018K14- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAACAGAGTTCG
rJMSF043I07- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF027D10- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF016J24- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF050E16- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMFF003E13- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF015J24- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
rJMSF013C02- ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
JMFN019M07+ ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
                      ____________________________________________________________
consensus ACCTTAGGTACTCGTCGTCCATTCTTGACAAAGCCGAGTGGATTCTCTTAGCAGAGTTCG
 
. : . : . : . : . : . :
rJMFF023A18- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF051G09- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF029O21- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF043G08- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF023L10- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF023H21- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF018K14- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF043I07- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF027D10- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF016J24- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF050E16- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMFF003E13- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCAGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF015J24- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
rJMSF013C02- TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
JMFN019M07+ TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
                      ____________________________________________________________
consensus TCAGTGGCTCGGATTGGAGCTCCCGGGACTCCGCCATTGGCGTGGCGGTGAACACCACGT
 
. : . : . : . : . : . :
rJMFF051G09- TGCCCA
rJMFF029O21- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMFF043G08- TGCCCAA
rJMSF023L10- TGCCCAAGTAGCCTGGCGGGANGGGCGGGCACAGCCTGGACCGACCATCGGTTGCNACGT
rJMFF023H21- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMFF018K14- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF043I07- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF027D10- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF016J24- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF050E16- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMFF003E13- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF015J24- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
rJMSF013C02- TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
JMFN019M07+ TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
                      ____________________________________________________________
consensus TGCCCAAGTAGCCTGGCGGGAGGGGCGGGCACAGCCTGGACCGACCATCGGTTGCAACGT
 
. : . : . : . : . : . :
rJMFF029O21- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGG
rJMSF023L10- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCT
rJMFF023H21- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMFF018K14- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF043I07- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF027D10- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF016J24- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF050E16- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMFF003E13- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF015J24- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
rJMSF013C02- ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
JMFN019M07+ ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
                      ____________________________________________________________
consensus ATAGTTTAGTGGATTGGTCATCAGTGAGCCCCCGGGCCTTGCAGGCACAGCGCCATATAT
 
. : . : . : . : . : . :
rJMFF023H21- GTGCTGCCAGGATCTCGTACGTGCTC
rJMFF018K14- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGG
rJMSF043I07- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
rJMSF027D10- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
rJMSF016J24- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
rJMSF050E16- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
rJMFF003E13- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGANGACCCCGA
rJMSF015J24- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGA
rJMSF013C02- GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
JMFN019M07+ GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
                      ____________________________________________________________
consensus GTGCTGCCAGGATCTCGTACGTGCTCCCCTCGTGCTTCGACTTCGTTTTGAGGACCCCGA
 
. : . : . : . : . : . :
rJMSF043I07- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
rJMSF027D10- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
rJMSF016J24- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
rJMSF050E16- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
rJMFF003E13- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
rJMSF013C02- GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
JMFN019M07+ GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
                      ____________________________________________________________
consensus GCTGTTCGGGCGTGATTTTAAGCATGGCTGTACTGGCACTGCTGCCTCGTTTCGATTCTG
 
. : . : . : . : . : . :
rJMSF043I07- GCACTGATTTTA
rJMSF027D10- GCACTGATT
rJMSF016J24- GCACTGA
rJMSF050E16- GCACTGATTT
rJMFF003E13- GCACTGATTTTA
rJMSF013C02- GCACTGATTTTA
JMFN019M07+ GCACTGATTTTAGCTTGGGAGGTTGGTCGTACTCGCTGTGCTCGAACGCCGGGGTCGGAG
                      ____________________________________________________________
consensus GCACTGATTTTAGCTTGGGAGGTTGGTCGTACTCGCTGTGCTCGAACGCCGGGGTCGGAG
 
. : . : . : . : . : . :
JMFN019M07+ GGTCCCGAGCACGGAGAAGAGTACGGTCTATGAACGGCGGGACAGCAACCGAGAGGCCCC
JMSF043I07+ TCCCGAGCACGGAGAAGAGTACGGTCTATGAACGGCGGGACAGCAACCGAGAGGCCCC
                      ____________________________________________________________
consensus GGTCCCGAGCACGGAGAAGAGTACGGTCTATGAACGGCGGGACAGCAACCGAGAGGCCCC
 
. : . : . : . : . : . :
JMFN019M07+ GGGCCATGTCTGCCCATGTATTGATGAAATGAAGGGACGAGACACCGTCAGAAAGTGTAT
JMSF043I07+ GGGCCATGTCTGCCCATGTATTGATGAAATGAAGGGACGAGACACCGTCAGAAAGTGTAT
JMSF027D10+ TGATGAAATGAAGGGACGAGACACCGTCAGAAAGTGTAT
JMSF050E16+ GACGAGACACCGTCAGAAAGTGTAT
JMSF023L10+ GACGAGACACCGTCAGAAAGTGTAT
                      ____________________________________________________________
consensus GGGCCATGTCTGCCCATGTATTGATGAAATGAAGGGACGAGACACCGTCAGAAAGTGTAT
 
. : . : . : . : . : . :
JMFN019M07+ GAAACGCCCCGGTTCCAA
JMSF043I07+ GAAACGCCCCGGTTCCAACACACACTCCACCACACTTGAAACGGG-TTACCTGGAAAATG
JMSF027D10+ GAAACGCCCCGGTTCCAACACACATTCCACCACACTTGAAACGGG-TTACCTGGAAAATG
JMSF050E16+ GAAACGCCCCGGTTCCAACACACANTCCACCACACTTGAAACGGG-TTACCTGGAAAATG
JMFF043G08+ CCACCACACTTGAAACGGGTTTACCTGGAAAATG
JMFF051G09+ GG-TTACCTGGAAAATG
JMSF023L10+ GAAACGCCCCGGTTCCAACACACANTCCACCACACTTGAAACGGG-TTACCTGGAAAATG
                      ____________________________________________________________
consensus GAAACGCCCCGGTTCCAACACACATTCCACCACACTTGAAACGGG-TTACCTGGAAAATG
 
. : . : . : . : . : . :
JMSF043I07+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
JMSF027D10+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
JMSF050E16+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
JMFF043G08+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
JMFF051G09+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
JMSF023L10+ ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
                      ____________________________________________________________
consensus ATGAGTGGGAAAGAGGAGATATCCCCAGAAGTATCAACAGTGGGAATGAACTTCCTGAGC
 
. : . : . : . : . : . :
JMSF043I07+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
JMSF027D10+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
JMSF050E16+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
JMFS050G02+ CAAGNTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTNTCAGCCTCCACA
JMFF043G08+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
JMFF051G09+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
JMFF029O21+ GGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTNNCAGCCTCCACA
JMFF003E13+ TCCACA
JMFF023A18+ TCCACA
JMSF023L10+ TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
                      ____________________________________________________________
consensus TCCAAGCTAGGAGTAAAGTCCCCAAAATCATCAACACAAGCATCACTCTCAGCCTCCACA
 
. : . : . : . : . : . :
JMSF043I07+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMSF027D10+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMSF050E16+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFS050G02+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFF043G08+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFF051G09+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFF029O21+ AACAGAACCCCTTCTT-CATTACAGTCAATCTNCAACCCTCCC-TTCCCCATCTNTGGCC
JMFF023H21+ TACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFF003E13+ AACAGAACCCNTTNTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMFF023A18+ AACAGAACCCNTTCTTCCATTACAGTCAATCT-CAACCCTCCCTTTCCCCATCTCTGGCC
JMFF018K14+ TACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMSF023L10+ AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
JMSF016J24+ TCTGGCC
                      ____________________________________________________________
consensus AACAGAACCCCTTCTT-CATTACAGTCAATCT-CAACCCTCCC-TTCCCCATCTCTGGCC
 
. : . : . : . : . : . :
JMSF043I07+ AGCCTCCCAGCCATGGGGTAAAATGAGATCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMSF027D10+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMSF050E16+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFS050G02+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF043G08+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF051G09+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF029O21+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF023H21+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF003E13+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF023A18+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMFF018K14+ AGCCTCTCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMSF023L10+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
JMSF016J24+ AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
                      ____________________________________________________________
consensus AGCCTCCCAGCCATGGGGTAAAATGAGACCAAAACATTGCTCAGAGCCTCCTTCATCACC
 
. : . : . : . : . : . :
JMSF043I07+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMSF027D10+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMSF050E16+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFS050G02+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF043G08+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF051G09+ TTGGGATCAAAGAAATTTGGGGACCCATTTGTCCTGTAGAAGTACACAGTCAACAAATGG
JMFF029O21+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF023H21+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF003E13+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF023A18+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMFF018K14+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMSF023L10+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMSF016J24+ TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
JMSF015J24+ GGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
                      ____________________________________________________________
consensus TTGGGATCAAAGAAATTTGGGGACCCATTTGGCCTGTAGAAGTACACAGTCAACAAATGG
 
. : . : . : . : . : . :
JMSF043I07+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMSF027D10+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMSF050E16+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFS050G02+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF043G08+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF051G09+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF029O21+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF023H21+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF003E13+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF023A18+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMFF018K14+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMSF023L10+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMSF016J24+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
JMSF015J24+ ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
                      ____________________________________________________________
consensus ATCCTCCCCACTATCAAATCCAGATTTGAGTTCCACACCCTCTTGGCTGGTGTGGGTTTT
 
. : . : . : . : . : . :
JMSF043I07+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMSF027D10+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMSF050E16+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFS050G02+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF043G08+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF051G09+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF029O21+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF023H21+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF003E13+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF023A18+ GCTGNCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMFF018K14+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMSF023L10+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMSF016J24+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
JMSF015J24+ GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
                      ____________________________________________________________
consensus GCTGGCTTCACCATTGTTGACTCCTTTATGCTAATCTTGAACTTCTCACTTGCCATATTT
 
. : . : . : . : . : . :
JMSF043I07+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMSF027D10+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMSF050E16+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFS050G02+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF043G08+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF051G09+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF029O21+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTNGTGTATAG
JMFF023H21+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF003E13+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF023A18+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMFF018K14+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMSF023L10+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMSF016J24+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
JMSF015J24+ GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
                      ____________________________________________________________
consensus GCTCAAAAATATGGACCAAGAATCAAGATCAGATAAAAAAGACACAAACTTTGTGTATAG
 
. : . : . : . : . : . :
JMSF043I07+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMSF027D10+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMSF050E16+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFS050G02+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF043G08+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF051G09+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF029O21+ ATTTCTCTATATATTTNGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF023H21+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF003E13+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF023A18+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMFF018K14+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMSF023L10+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMSF016J24+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
JMSF015J24+ ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
                      ____________________________________________________________
consensus ATTTCTCTATATATTTTGATTCAAATGGAAGAATAGAGAAACAAGTGTATGGACTATGGA
 
. : . : . : . : . : . :
JMSF043I07+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTT
JMSF027D10+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC
JMSF050E16+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC
JMFS050G02+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGT
JMFF043G08+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTT
JMFF051G09+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCT
JMFF029O21+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGAC
JMFF023H21+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGAC
JMFF003E13+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGAC
JMFF023A18+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGAC
JMFF018K14+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGA
JMSF023L10+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC
JMSF016J24+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC
JMSF015J24+ GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC
                      ____________________________________________________________
consensus GTTTGGTTATCACTTGCCTCACCACAACAGGGAGAGAATGTGTGATAGGCCTTTGAGACC