Previous Contig 005563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029P18Sequence466005563 (6)431005563 (6)
JMSF015J23Sequence404005563 (6)492005563 (6)
JMSF033L07Sequence296005563 (6)331005563 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029P18+ TTTTTTTTNTACTACT
                      ____________________________________________________________
consensus TTTTTTTTNTACTACT
 
. : . : . : . : . : . :
rJMFF029P18- TAGGGTTTCATATCATCTATTTACACATTTCATCATCAAAG
rJMSF033L07- TTTCATCATCAAAG
JMFF029P18+ TTGAAATAGTAAAATTCCATAGGGTTTCATATCATCTATTTACACATTTCATCATCAAAG
rJMSF015J23- TTTCATCATCAAAG
                      ____________________________________________________________
consensus TTGAAATAGTAAAATTCCATAGGGTTTCATATCATCTATTTACACATTTCATCATCAAAG
 
. : . : . : . : . : . :
rJMFF029P18- GTAAATAACAT-GACACATT-GAGAAGAAATTAAAAACAATCAACAACTCTTGGCAAGAA
rJMSF033L07- GTAAATAACATGGACACATTGGAGAAGAAATTAAAAACAATCAACAACTCTTGGCAAGAA
JMSF033L07+ GAAGAAATTAAAAACAATCAACAACTNTTGGCAAGAA
JMFF029P18+ GTAAATAACAT-GACNCATT-GAGAAGAAATTAAAAACAATCAACAACTCTTGGCAAGAA
rJMSF015J23- GTAAATAACAT-GACACATT-GAGAAGAAATTAAAAACAATCAACAACTCTTGGCAAGAA
                      ____________________________________________________________
consensus GTAAATAACAT-GACACATT-GAGAAGAAATTAAAAACAATCAACAACTCTTGGCAAGAA
 
. : . : . : . : . : . :
rJMFF029P18- AATTT-AAAAAAAAAAAATTAAAAATTTATTTGGGTGATGAATTAAGCANAGAANAATCC
rJMSF033L07- AATTTAAAAAAAAAAAAATTAAAAATTTATTTGGGNGATGAATTAAGCAGAGAANAATCC
JMSF033L07+ AATTTAAAAAAAAAAAAATTAAAAATTTATTTGGGTGATGAATTAAGCAGAGAAGAATCC
JMFF029P18+ AATTT-AAAAAAAAAAAATTAAAAATTTATTTGGGTGATGAATTAAGCAGAGAAGAATCC
rJMSF015J23- AATTTAAAAAAAAAAAAATTAAAAATTTATTTGGGNGATGAATTAAGCANAGAANAATCC
JMSF015J23+ AATTAAAAATTTATTTGGGTGATGAATTAAGCAGAGAAGAATCC
                      ____________________________________________________________
consensus AATTTAAAAAAAAAAAAATTAAAAATTTATTTGGGTGATGAATTAAGCAGAGAAGAATCC
 
. : . : . : . : . : . :
rJMFF029P18- ATTTCTGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
rJMSF033L07- ATTTCNGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
JMSF033L07+ ATTTCTGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
JMFF029P18+ ATTTCTGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
rJMSF015J23- ATTTCNGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
JMSF015J23+ ATTTCTGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
                      ____________________________________________________________
consensus ATTTCTGGCTGCAACAGCAACCTCAAAATGAGGCTGCAAAACCTTGTTCTTCATTATCAT
 
. : . : . : . : . : . :
rJMFF029P18- CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAANAANA
rJMSF033L07- CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAANAANA
JMSF033L07+ CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAAGAAGA
JMFF029P18+ CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAAGAAGA
rJMSF015J23- CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAANAANA
JMSF015J23+ CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAAGAAGA
                      ____________________________________________________________
consensus CACCTCTAACCTCTTCTCCTCTCCACCACTGAGCTTCACCTTCACCAAAGAGGAAGAAGA
 
. : . : . : . : . : . :
rJMFF029P18- GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
rJMSF033L07- GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
JMSF033L07+ GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
JMFF029P18+ GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
rJMSF015J23- GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
JMSF015J23+ GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
                      ____________________________________________________________
consensus GCCTTCAAGTTTCTGACCCTCACTGCCGCCGCCGCCCAGTTTTCTTGCATTCTTGATCCT
 
. : . : . : . : . : . :
rJMFF029P18- CCTCTCGTATTCCTCCGCCACCAGGATAGCTATGTCCGCCATATATATGTGTAGCTTAGC
rJMSF033L07- CCTCTCGTATTCCTC
JMSF033L07+ CCTCTCGTATTCCTC
JMFF029P18+ CCTCTCGTATTCCTCCGCCACCAGGATAGCTATGTCCGCCATATATATGTGTAGCTTAGC
rJMSF015J23- CCTCTCGTATTCCTCCGCCACCAGGATAGCTATGTCCGCCATATATATGTGTAGCTTAGC
JMSF015J23+ CCTCTCGTATTCCTCCGCCACCAGGATAGCTATGTCCGCCATATATATGTGTAGCTTAGC
                      ____________________________________________________________
consensus CCTCTCGTATTCCTCCGCCACCAGGATAGCTATGTCCGCCATATATATGTGTAGCTTAGC
 
. : . : . : . : . : . :
rJMFF029P18- TTTCANAGTTGCTTTTGCTCAATGGGCATATCT
JMFF029P18+ TTTCAGAGTTGCTTTTGCTCAATGGGCATATCT
rJMSF015J23- TTTCANAGTTGCTTTTGCTCAANGGGCATATCTGGATAGGCCAATTCACAGGGCATATAT
JMSF015J23+ TTTCAGAGTTGCTTTTGCTCAATGGGCATATCTGGATAGGCCAATTCACAGGGCATATAT
                      ____________________________________________________________
consensus TTTCAGAGTTGCTTTTGCTCAATGGGCATATCTGGATAGGCCAATTCACAGGGCATATAT
 
. : . : . : . : . : . :
rJMSF015J23- AACAGAAGCAGGNGGGTTCTTANACAGGAGTGGATAAGGTTGCCAATTGCCATGTGCATC
JMSF015J23+ AACAGAAGCAGGTGGGTTCTTAGACAGGAGTGGATAAGGTTGCCAATTGCCATGTGCATC
                      ____________________________________________________________
consensus AACAGAAGCAGGTGGGTTCTTAGACAGGAGTGGATAAGGTTGCCAATTGCCATGTGCATC