Previous Contig 005562:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS079H07Sequence626005562 (6)pir|T02333|T023334e-71hypothetical protein At2g34460 [imported] - Arabidopsis thaliana>gb:BT000884_163
JMSF015J13Sequence565005562 (6)pir|T02333|T023335e-49hypothetical protein At2g34460 [imported] - Arabidopsis thaliana>gb:BT000884_163
JMSF028B14Sequence639005562 (6)pir|T02333|T023331e-60hypothetical protein At2g34460 [imported] - Arabidopsis thaliana>gb:BT000884_163789005562 (6)gb:AY034977_15597577e-89Arabidopsis thaliana unknown protein (At2g34460) mRNA, partial cds.
JMSF040M02Sequence639005562 (6)pir|T02333|T023332e-60hypothetical protein At2g34460 [imported] - Arabidopsis thaliana>gb:BT000884_163871005562 (6)gb:AY034977_1559757e-100Arabidopsis thaliana unknown protein (At2g34460) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028B14- GTTTCAGGTGAAA
                      ____________________________________________________________
consensus GTTTCAGGTGAAA
 
. : . : . : . : . : . :
rJMSF028B14- AATATAATGTATACATAGGTAGTTGAAACT-GCCATCAAGGGGGAATGAAAGGATAAACA
rJMSF040M02- GGTAGTTGAAACTGGCCATCAAGGGGGAATGAAAGGATAAACA
                      ____________________________________________________________
consensus AATATAATGTATACATAGGTAGTTGAAACTGGCCATCAAGGGGGAATGAAAGGATAAACA
 
. : . : . : . : . : . :
rJMSF028B14- GTTGTATTATGGCGTACGGTGGTAACAGAAAGTTGGACACAAGTGAGCAAGTTACCGTGG
rJMSF040M02- GTTGTATTATGGCGTACGGTGGTAACAGAAAGTTGGACACAAGTGAGCAAGTTACCGTGG
                      ____________________________________________________________
consensus GTTGTATTATGGCGTACGGTGGTAACAGAAAGTTGGACACAAGTGAGCAAGTTACCGTGG
 
. : . : . : . : . : . :
rJMSF028B14- TTTTATAGAAGCAAAAAGTTCCTTGAACGAACGCTTAGGGGCTTCGGTTCTAGCAACTAT
rJMSF040M02- TTTTATAGAAGCAAAAAGTTCCTTGAACGAACGCTTAGGGGCTTCGGTTCTAGCAACTAT
                      ____________________________________________________________
consensus TTTTATAGAAGCAAAAAGTTCCTTGAACGAACGCTTAGGGGCTTCGGTTCTAGCAACTAT
 
. : . : . : . : . : . :
rJMSF028B14- CTCCACCAATTTGTAGTGAGATTCTGGATGGAGCAACGCCTCGACTGCAACTTCAGCAAC
rJMSF040M02- CTCCACCACTTTGTAGTGAGATTCTGGATGGAGCAACGCCTCGACTGCAACTTCAGCAAC
                      ____________________________________________________________
consensus CTCCACCACTTTGTAGTGAGATTCTGGATGGAGCAACGCCTCGACTGCAACTTCAGCAAC
 
. : . : . : . : . : . :
rJMSF028B14- CTGATCTCTAGATATAGCACCTCCAGAAAGTGTATCCTCTGGCTCCATGACTATGTTTCC
rJMSF040M02- CTGATCTCTAGATATAGCACCTCCAGAAAGTGTATCCTCTGGCTCCATGACTATGTTTCC
                      ____________________________________________________________
consensus CTGATCTCTAGATATAGCACCTCCAGAAAGTGTATCCTCTGGCTCCATGACTATGTTTCC
 
. : . : . : . : . : . :
rJMSF028B14- ATTTGGAGGATCATTTCTCAGTCCACCAGGCCTTATGATTGTGTAATTGATCCCCGACCT
rJMSF040M02- ATTTGGAGGATCATTTCTCAGTCCACCAGGCCTTATGATTGTGTAATTGATCCCCGACCT
JMFS079H07+ CTCAGTCCACCAGGCCTTATGATTGTGTAATTGATCNCCGACCT
                      ____________________________________________________________
consensus ATTTGGAGGATCATTTCTCAGTCCACCAGGCCTTATGATTGTGTAATTGATCCCCGACCT
 
. : . : . : . : . : . :
rJMSF028B14- CCTTATGTACTGCTCTGCTTGAAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
rJMSF040M02- CCTTATGTACTGCTCTGCTTGAAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
JMFS079H07+ CCTTATGTACTGCTCTGCTTGAAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
JMSF040M02+ AAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
JMSF028B14+ AAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
                      ____________________________________________________________
consensus CCTTATGTACTGCTCTGCTTGAAGCTTCGCGATCAATGTCAGTCCAAACACATTAAGAAT
 
. : . : . : . : . : . :
rJMSF028B14- TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
rJMSF040M02- TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
JMFS079H07+ TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
JMSF040M02+ TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
JMSF028B14+ TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
JMSF015J13+ CTCCATTGACTAGGATAGAGCTTAT
                      ____________________________________________________________
consensus TATGTAGGATGGATTAAACAACTGTCCCATTGCAGCTCCATTGACTAGGATAGAGCTTAT
 
. : . : . : . : . : . :
rJMSF028B14- AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
rJMSF040M02- AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
JMFS079H07+ AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
JMSF040M02+ AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
JMSF028B14+ AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
JMSF015J13+ AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
                      ____________________________________________________________
consensus AAGGATAAACCTATTAACGCCTTGTTTTCTGCATGCATCAACGAGGTTTACGGTGCCAAA
 
. : . : . : . : . : . :
rJMSF028B14- GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
rJMSF040M02- GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
JMFS079H07+ GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
JMSF040M02+ GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
JMSF028B14+ GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
JMSF015J13+ GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
                      ____________________________________________________________
consensus GTTATCCACCTTCCATGGAGCCAATAAATCCCATGAAGGCCGAAATCCAGCTGCACATAT
 
. : . : . : . : . : . :
rJMSF028B14- CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
rJMSF040M02- CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
JMFS079H07+ CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
JMSF040M02+ CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
JMSF028B14+ CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
JMSF015J13+ CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
                      ____________________________________________________________
consensus CACTGCATCTGAATCTTCACCTATGGCATCACCTAATTTAGTAGCTCCCTCTGTTACATC
 
. : . : . : . : . : . :
rJMSF028B14- AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
rJMSF040M02- AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
JMFS079H07+ AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
JMSF040M02+ AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
JMSF028B14+ AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
JMSF015J13+ AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
                      ____________________________________________________________
consensus AGCTTTTACAATTTGAAGATGAGGGTTTCCGCCGGGTAAGCTTGTTTTGGCCTTATCTAC
 
. : . : . : . : . : . :
rJMSF028B14- ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCANAAGCTGT
rJMSF040M02- ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
JMFS079H07+ ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
JMSF040M02+ ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
JMSF028B14+ ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
JMSF015J13+ ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
                      ____________________________________________________________
consensus ATCGCGAACGCCTGCCTTAACAGCAAACCCCTTTGTCAGAAGCTGTTCAACTATCCTCTT
 
. : . : . : . : . : . :
rJMSF040M02- GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCCACTACCCGC
JMFS079H07+ GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCTACTACCCGC
JMSF040M02+ GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCCACTACCCGC
JMSF028B14+ GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCTACTACCCGC
JMSF015J13+ GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCTACTACCCGC
                      ____________________________________________________________
consensus GCCGGTGTTCCCAGTAGCACCTGCTACAAATATCTTCTTCTTCTTCTGGCTACTACCCGC
 
. : . : . : . : . : . :
rJMSF040M02- TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAG
JMFS079H07+ TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAGAAGAAAGGAGCG
JMSF040M02+ TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAGAAGAAAGGAGCG
JMSF028B14+ TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAGAAGAAAGGAGCG
JMSF015J13+ TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAGAAGAAAGGAGCG
                      ____________________________________________________________
consensus TTCTTCTTCCACCTTCATTTCACTTCCCTCCATATTTGATGCTTTGAGAAGAAAGGAGCG
 
. : . : . : . : . : . :
JMFS079H07+ GGAGCGGGATTTAGAAGGAAAGAGAGAGTGAGAGACTGAATT
JMSF040M02+ GGAGCGGGATTTAGAAGGAAAGAGAGAGTGAGAGACTGAATTAACAGTGAAGGAGGGGAA
JMSF028B14+ GGAGCGGGATTTAGAAGGAAAGAGAGAGTGAGAGACTGAATTAACAGTGAAGGAGGGGAA
JMSF015J13+ GGAGCGGGATTTAGAAGGAAAGAGAGAGTGAGAGACTGAATTAACAGTGAAGGAGGGGAA
                      ____________________________________________________________
consensus GGAGCGGGATTTAGAAGGAAAGAGAGAGTGAGAGACTGAATTAACAGTGAAGGAGGGGAA
 
. : . : . : . : . : . :
JMSF040M02+ GATAGAGGTTCTGAGGGAGAAGAGACCAGAAGCTGCCATTCGCGGCCGACCAGACAA
JMSF028B14+ GATAGAGGTTCTGAGGGAGAAGAGACCAGAAGCTGCCATTCGCGGCCGACCAGACAA
JMSF015J13+ GATAGAGGTTCTGAGGGAGAAGAGACCAGAAGCTGCCATTCGCGGCCGACCAGACAAACC
                      ____________________________________________________________
consensus GATAGAGGTTCTGAGGGAGAAGAGACCAGAAGCTGCCATTCGCGGCCGACCAGACAAACC