Previous Contig 005560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS098B09Sequence626005560 (2)gb:AJ620906_18123292e-88Antirrhinum majus mRNA for STY-L protein.
JMSF015J10Sequence557005560 (2)gb:AJ620906_18123292e-69Antirrhinum majus mRNA for STY-L protein.597022660gb:AJ620906_18123295e-57Antirrhinum majus mRNA for STY-L protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS098B09+ GAGTTGAATTCGGCCGGAACCGGACATCA
                      ____________________________________________________________
consensus GAGTTGAATTCGGCCGGAACCGGACATCA
 
. : . : . : . : . : . :
JMFS098B09+ GTTATTAAGTATTGATGCTCTTCTGGGGTCATCTCTGTTTGCAAAGTGTCCATGTTCCAA
                      ____________________________________________________________
consensus GTTATTAAGTATTGATGCTCTTCTGGGGTCATCTCTGTTTGCAAAGTGTCCATGTTCCAA
 
. : . : . : . : . : . :
JMFS098B09+ ATTACAGCCTTCTTGTCATGTCCAGCACTGGCTAACAACTTCCCATCCGAAGAAAAATGA
                      ____________________________________________________________
consensus ATTACAGCCTTCTTGTCATGTCCAGCACTGGCTAACAACTTCCCATCCGAAGAAAAATGA
 
. : . : . : . : . : . :
JMFS098B09+ CAGCAAGTTACTTTATTTCTTGTTCGAATACAACCAACTTCCCCAAAGGAAAACCCTTTA
JMSF015J10+ CAAAGGAAAACCCTTTA
                      ____________________________________________________________
consensus CAGCAAGTTACTTTATTTCTTGTTCGAATACAACCAACTTCCCCAAAGGAAAACCCTTTA
 
. : . : . : . : . : . :
JMFS098B09+ GGCTCTGGTTTGTGCTCAGTGAGAGATTGTTTCAGTGTGCCATATATATTTCCATCTCCC
JMSF015J10+ GGCTCTGGTTTGTGCTCAGTGAGAGATTGTTTCAGTGTGCCATATATATTTCCATCTCCC
                      ____________________________________________________________
consensus GGCTCTGGTTTGTGCTCAGTGAGAGATTGTTTCAGTGTGCCATATATATTTCCATCTCCC
 
. : . : . : . : . : . :
JMFS098B09+ CCATCATGTGACAAAAAAGATTCCACATTATCTTCCAGAGAACCAATGTCTCCAAAATTC
JMSF015J10+ CCATCATGTGACAAAAAAGATTCCACATTATCTTCCAGAGAACCAATGTCTCCAAAATTC
                      ____________________________________________________________
consensus CCATCATGTGACAAAAAAGATTCCACATTATCTTCCAGAGAACCAATGTCTCCAAAATTC
 
. : . : . : . : . : . :
JMFS098B09+ TCCAAGTCATCCAGCTGATTCGTAGATGATGCAATACCACCAGTTCCCTCAGCACCATAC
JMSF015J10+ TCCAAGTCATCCAGCTGATTCGTAGATGATGCAATACCACCAGTTCCCTCAGCACCATAC
                      ____________________________________________________________
consensus TCCAAGTCATCCAGCTGATTCGTAGATGATGCAATACCACCAGTTCCCTCAGCACCATAC
 
. : . : . : . : . : . :
JMFS098B09+ ATGATCAAGCTCTTTGAAACACTGTTGACATGTTGCATGCTACTAGCAGTGCCCATTGCA
JMSF015J10+ ATGATCAAGCTCTTTGAAACACTGTTGACATGTTGCATGCTACTAGCAGTGCCCATTGCA
                      ____________________________________________________________
consensus ATGATCAAGCTCTTTGAAACACTGTTGACATGTTGCATGCTACTAGCAGTGCCCATTGCA
 
. : . : . : . : . : . :
JMFS098B09+ TCACCAGGTGTGTGTGTCGATGGTGGTGAATTTGGAGAAGGACCAACTGTATTCCCAGTG
JMSF015J10+ TCACCAGGTGTGTGTGTCGATGGTGGTGAATTTGGAGAAGGACCAACTGTATTCCCAGTG
                      ____________________________________________________________
consensus TCACCAGGTGTGTGTGTCGATGGTGGTGAATTTGGAGAAGGACCAACTGTATTCCCAGTG
 
. : . : . : . : . : . :
JMFS098B09+ CCTGTACTATTGGCAGGTCCAGACGAGGAATGCTGCTTCCTTTTCCTGTTAGTCTGCTGC
JMSF015J10+ CCTGTACTATTGGCAGGTCCAGACGAGGAATGCTGCTTCCTTTTCCTGTTAGTCTGCTGC
                      ____________________________________________________________
consensus CCTGTACTATTGGCAGGTCCAGACGAGGAATGCTGCTTCCTTTTCCTGTTAGTCTGCTGC
 
. : . : . : . : . : . :
JMFS098B09+ AATTGCTGTTGCTGTTGCAGTTGGTCCTGTTGTTGAGAGGAAGATTGCTGCATTTGG
JMSF015J10+ AATTGCTGTTGCTGTTGCAGTTGGTCCTGTTGTTGAGAGGAAGATTGCTGCATTTGGGGC
                      ____________________________________________________________
consensus AATTGCTGTTGCTGTTGCAGTTGGTCCTGTTGTTGAGAGGAAGATTGCTGCATTTGGGGC
 
. : . : . : . : . : . :
JMSF015J10+ ATCTTCATCTTCGGGGAATTTGATTGCACAGGAGAACATATAGATCCATCATTTCTTGGG
                      ____________________________________________________________
consensus ATCTTCATCTTCGGGGAATTTGATTGCACAGGAGAACATATAGATCCATCATTTCTTGGG
 
. : . : . : . : . : . :
JMSF015J10+ GGTTGACCATCTTTTGGATTAAAGTTACCCCTTGGTAATCCACCAAAACCATAATTAGGC
                      ____________________________________________________________
consensus GGTTGACCATCTTTTGGATTAAAGTTACCCCTTGGTAATCCACCAAAACCATAATTAGGC