Previous Contig 005559:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS124D04Sequence572005559 (3)
JMSF015J09Sequence586005559 (3)774011837 (2)gb:BT003145_16367265e-09Arabidopsis thaliana At4g26450 mRNA, complete cds.>gb:AK118341_1816324 Arabidops
JMSF045O15Sequence729005559 (3)gb:BT003145_16367263e-16Arabidopsis thaliana At4g26450 mRNA, complete cds.>gb:AK118341_1816324 Arabidops627011837 (2)gb:BT003145_16367260.042Arabidopsis thaliana At4g26450 mRNA, complete cds.>gb:AK118341_1816324 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045O15+ TCACCCAGTTCTTATCACGTCCATGTTCAACAACCACAGG
                      ____________________________________________________________
consensus TCACCCAGTTCTTATCACGTCCATGTTCAACAACCACAGG
 
. : . : . : . : . : . :
JMSF045O15+ TTTGGTGTACCGCATTTTTGGGGCACTAGCTGCAGTTGAAGACCTACTGCTCTGACCCTC
                      ____________________________________________________________
consensus TTTGGTGTACCGCATTTTTGGGGCACTAGCTGCAGTTGAAGACCTACTGCTCTGACCCTC
 
. : . : . : . : . : . :
JMSF045O15+ ACTGTTCTCCGAGTCCGTCCCAGCCATGAAAGCAGGTCCATTAACTGCCCCTGTATCACC
                      ____________________________________________________________
consensus ACTGTTCTCCGAGTCCGTCCCAGCCATGAAAGCAGGTCCATTAACTGCCCCTGTATCACC
 
. : . : . : . : . : . :
JMSF045O15+ AATTCCACCAAAGCAATCAAACAGCTGACCAGGACTCCTCATAAAGGCAACTGTAGATGA
                      ____________________________________________________________
consensus AATTCCACCAAAGCAATCAAACAGCTGACCAGGACTCCTCATAAAGGCAACTGTAGATGA
 
. : . : . : . : . : . :
JMSF045O15+ ATTAGATCCCTCACTTTTCTGCATTACTCCAGCAGAAAAATGCCCAGGTTTCGCTGGATT
                      ____________________________________________________________
consensus ATTAGATCCCTCACTTTTCTGCATTACTCCAGCAGAAAAATGCCCAGGTTTCGCTGGATT
 
. : . : . : . : . : . :
JMSF045O15+ ATTACCTCCTGAATGTGACAAACCCCTCTTCAACATCTTGCTAGTGTCTATGTTAGTATC
                      ____________________________________________________________
consensus ATTACCTCCTGAATGTGACAAACCCCTCTTCAACATCTTGCTAGTGTCTATGTTAGTATC
 
. : . : . : . : . : . :
JMSF045O15+ CCCATCCATCCGTGCTTCTTTTTTGAACCTCCTCCATTTCCTCAAACCCTTTCCTTTCGT
JMFS124D04+ T
                      ____________________________________________________________
consensus CCCATCCATCCGTGCTTCTTTTTTGAACCTCCTCCATTTCCTCAAACCCTTTCCTTTCGT
 
. : . : . : . : . : . :
JMSF045O15+ ACTCATAGGTATAGGTGTAGATTTGACATCCACAACTGGAGGCATATCCCCAGCCTCCTC
JMFS124D04+ ACTCATAGGTATAGGTGTAGATTTGACATCCACAACTGGAGGCATATCCCCAGCCTCCTC
                      ____________________________________________________________
consensus ACTCATAGGTATAGGTGTAGATTTGACATCCACAACTGGAGGCATATCCCCAGCCTCCTC
 
. : . : . : . : . : . :
JMSF045O15+ CACAACTTCATTTCCCTTCCCATTCATTTGCTTTTGCTCAGCCACGCCACATCCATTATT
JMFS124D04+ CACAACTTCATTTCCCTTCCCATTCATTTGCTTTTGCTCAGCCACGCCACATCCATTATT
JMSF015J09+ CCTTCCCATTCATTNGCTTTTGNTCAGCCACGCCACATCCATTATT
                      ____________________________________________________________
consensus CACAACTTCATTTCCCTTCCCATTCATTTGCTTTTGCTCAGCCACGCCACATCCATTATT
 
. : . : . : . : . : . :
JMSF045O15+ TGACACTTGTTGTTCAGCCGAATTAGTATCCAACTTTTCAGCATTTATATTGCTTATTGC
JMFS124D04+ TGACACTTGTTGTTCAGCCGAATTAGTATCCAACTTTTCAGCATTTATATTGCTTATTGC
JMSF015J09+ TGACACTTGTTGTTCAGCCGAATTAGTATCCAACTTTTCAGCATTTATATTGCTTATTGC
                      ____________________________________________________________
consensus TGACACTTGTTGTTCAGCCGAATTAGTATCCAACTTTTCAGCATTTATATTGCTTATTGC
 
. : . : . : . : . : . :
JMSF045O15+ TTCGTTATCCTGCGCAGATTCAAGAGCTGAACATTCCCTCTCCAATTCCATCACT
JMFS124D04+ TTCGTTATCCTGCGCAGATTCAAGAGCTGAACATTCCCTCTCCAATTCCATCACTACAAC
JMSF015J09+ TTCGTTATCCTGCGCAGATTCAAGAGCTGAACATTCCCTCTCCAATTCCATCACTACAAC
                      ____________________________________________________________
consensus TTCGTTATCCTGCGCAGATTCAAGAGCTGAACATTCCCTCTCCAATTCCATCACTACAAC
 
. : . : . : . : . : . :
JMFS124D04+ AATTACAAAACTTTCAGCTCAGATGAAGAAAGCTCAGAAATCCAATATCAAAATCAGATC
JMSF015J09+ AATTACAAAACTTTCAGCTCAGATGAAGAAAGCTCAGAAATCCAATATCAAAATCAGATC
                      ____________________________________________________________
consensus AATTACAAAACTTTCAGCTCAGATGAAGAAAGCTCAGAAATCCAATATCAAAATCAGATC
 
. : . : . : . : . : . :
JMFS124D04+ AAGATCAAGAAGTAGCGACTGAAATTCCGGCAGAGGATTAATTGATCATAATCTTGAAAT
JMSF015J09+ AAGATCAAGAAGTAGCGACTGAAATTCCGGC--AGGATTAATTGATCATAATCTTGAAAT
                      ____________________________________________________________
consensus AAGATCAAGAAGTAGCGACTGAAATTCCGGCAGAGGATTAATTGATCATAATCTTGAAAT
 
. : . : . : . : . : . :
JMFS124D04+ CCGCTAAAACTGATAACTCTCTCTTTTTTTCTTTTTTCTTTTTTAAATGGAGTAGTTAGA
JMSF015J09+ CCGCTAAAACTGATAACTCTCTCTTTTTTTCTTTTTTCTTTTTTAAATGGAGTAGTTAGA
                      ____________________________________________________________
consensus CCGCTAAAACTGATAACTCTCTCTTTTTTTCTTTTTTCTTTTTTAAATGGAGTAGTTAGA
 
. : . : . : . : . : . :
JMFS124D04+ AATCAGTATTCTCCGATATTGTATCGAATCTCTCAAAACCAGTTGGAATTTAATTTAAGA
JMSF015J09+ AATCAGTATTCTCCGATATTGTATCGAATCTCTCAAAACCAGTTGGAATTTAATTTAAGA
                      ____________________________________________________________
consensus AATCAGTATTCTCCGATATTGTATCGAATCTCTCAAAACCAGTTGGAATTTAATTTAAGA
 
. : . : . : . : . : . :
JMFS124D04+ GAAGCTAATCAAACTGAAACAAATGAACATTAGGAAGCATAAAGTAATGATCATCGTACC
JMSF015J09+ GAAGCTAATCAAACTGAAACAAATGAACATTAGGAAGCATAAAGTAATGATCATCGTACC
                      ____________________________________________________________
consensus GAAGCTAATCAAACTGAAACAAATGAACATTAGGAAGCATAAAGTAATGATCATCGTACC
 
. : . : . : . : . : . :
JMFS124D04+ TTTTGTTTCATTATTGTGGATTTTGCAGATG
JMSF015J09+ TTTTGTTTCATTATTGTGGATTTTGCAGATGCGGAAATAGAGAAACCCTAGAAGCTCTGT
                      ____________________________________________________________
consensus TTTTGTTTCATTATTGTGGATTTTGCAGATGCGGAAATAGAGAAACCCTAGAAGCTCTGT
 
. : . : . : . : . : . :
JMSF015J09+ GGATTTGAAGATTTATACCCTCGAAATTTAAGGTGATCAGCAAATCAGCGATCTCTGTTC
                      ____________________________________________________________
consensus GGATTTGAAGATTTATACCCTCGAAATTTAAGGTGATCAGCAAATCAGCGATCTCTGTTC