Previous Contig 005549:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014O21Sequence458005549 (2)gb:AF138858_17713904e-23Lycopersicon esculentum polygalacturonase (XOPG1) mRNA, complete cds.
JMSF015H04Sequence241005549 (2)pir|S57806|S578064e-07polygalacturonase precursor - tomato>gb:LEU23053_1684722 Lycopersicon esculentum

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014O21+ TTGTCCATCAATTACCCCTCCACCATTAACAATCAGCCCAT
                      ____________________________________________________________
consensus TTGTCCATCAATTACCCCTCCACCATTAACAATCAGCCCAT
 
. : . : . : . : . : . :
JMFF014O21+ ATACACCATTGAAACTTAGCCACTGACTTGTGTCGAGCCCATTCCAACCCGGTGGTGAGC
                      ____________________________________________________________
consensus ATACACCATTGAAACTTAGCCACTGACTTGTGTCGAGCCCATTCCAACCCGGTGGTGAGC
 
. : . : . : . : . : . :
JMFF014O21+ CCGGTGCAACAACCGTACCCGACACTATGAAATGGATATGTTGAGACTTGCAGGGGCCAT
                      ____________________________________________________________
consensus CCGGTGCAACAACCGTACCCGACACTATGAAATGGATATGTTGAGACTTGCAGGGGCCAT
 
. : . : . : . : . : . :
JMFF014O21+ TAAATTGAACTGGTTTAACCAGAAACGTCGAGCCTGCAGGAATGATCACTTGAGGAGACT
JMSF015H04+ T
                      ____________________________________________________________
consensus TAAATTGAACTGGTTTAACCAGAAACGTCGAGCCTGCAGGAATGATCACTTGAGGAGACT
 
. : . : . : . : . : . :
JMFF014O21+ TATGCACAGGAGTCGAAGAACATGCATCCTTCCATGCATTCAGAAAAGCTTGGGAATCAT
JMSF015H04+ TATGCACAGGAGTCGAAGAACATGCATCCTTCCATGCATTCAGAAAAGCTTGGGAATCAT
                      ____________________________________________________________
consensus TATGCACAGGAGTCGAAGAACATGCATCCTTCCATGCATTCAGAAAAGCTTGGGAATCAT
 
. : . : . : . : . : . :
JMFF014O21+ CTGTCATTCCATCCCCTTTGGCTCCATAGTCTATCACATTAAAGCTTTTGCAAGAAACTC
JMSF015H04+ CTGTCATTCCATCCCCTTTGGCTCCATAGTCTATCACATTAAAGCTTTTGCAAGAAACTC
                      ____________________________________________________________
consensus CTGTCATTCCATCCCCTTTGGCTCCATAGTCTATCACATTAAAGCTTTTGCAAGAAACTC
 
. : . : . : . : . : . :
JMFF014O21+ TTGATGATGATATCAAGCCAAGAATGAACAAAAAAACAAAAACCTCCATGCTATAGAAGC
JMSF015H04+ TTGATGATGATATCAAGCCAAGAATGAACAAAAAAACAAAAACCTCCATGCTATAGAAGC
                      ____________________________________________________________
consensus TTGATGATGATATCAAGCCAAGAATGAACAAAAAAACAAAAACCTCCATGCTATAGAAGC
 
. : . : . : . : . : . :
JMFF014O21+ AGCAGTAAAGGGCAAATATAGATGCAGAAAGGATTAATCATGGGTGAATAGTATAAT
JMSF015H04+ AGCAGTAAAGGGCAAATATAGATGCAGAAAGGATTAATCATGGGTGAATAGTATAATACC
                      ____________________________________________________________
consensus AGCAGTAAAGGGCAAATATAGATGCAGAAAGGATTAATCATGGGTGAATAGTATAATACC