Previous Contig 005548:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS009D12Sequence610005548 (8)gb:ATH010466_15518995e-76Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.
JMSF015H03Sequence221005548 (8)759013055 (8)gb:AY052303_1562676e-114Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF020N14Sequence451005548 (8)gb:AY052303_15626766e-68Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531 806013055 (8)gb:AY052303_15626764e-94Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF022E20Sequence707005548 (8)gb:ATH010466_15518991e-87Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.760013055 (8)gb:AY052303_15626764e-91Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF033A20Sequence707005548 (8)gb:ATH010466_15518993e-88Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.658013055 (8)gb:AY052303_15626761e-71Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF036L14Sequence682005548 (8)gb:ATH010466_15518997e-83Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.712013055 (8)gb:AY052303_15626766e-81Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF048B09Sequence709005548 (8)gb:ATH010466_15518993e-88Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.811013055 (8)gb:AY052303_1562676e-101Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds.>gb:AY059168_1564531
JMSF049G03Sequence682005548 (8)gb:ATH010466_15518997e-83Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15.759014046 (2)gb:ATAC002343_15427826e-51Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033A20+ CATTCATCAAGTATAAAATGCCTCACATTCATCAAGGAAAGATGCTTTT
JMSF022E20+ TTCATCAAGTATAAAATGCCTCACATTCATCAAGGAAAGATGCTTTT
JMSF048B09+ TTCATCAAGTATAAAATGCCTCACATTCATCAAGGAAAGATGCTTTT
JMSF049G03+ TTCATCAAGGAAAGATGCTTTT
JMSF036L14+ TTCATCAAGGAAAGATGCTTTT
                      ____________________________________________________________
consensus CATTCATCAAGTATAAAATGCCTCACATTCATCAAGGAAAGATGCTTTT
 
. : . : . : . : . : . :
JMFS009D12+ GGAGTTCCAACAACAATGTGAGGGCATTCATTCT
JMSF033A20+ CCCTTGATAATGCAAGAATTCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
JMSF020N14+ AATGTGAGGGCATTCATTCT
JMSF022E20+ CCCTTGATAATGCAAGAATTCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
JMSF048B09+ CCCTTGATAATGCAAGAATTCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
JMSF049G03+ CCCTTGATAATGCAAGAATCCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
JMSF036L14+ CCCTTGATAATGCAAGAATTCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
                      ____________________________________________________________
consensus CCCTTGATAATGCAAGAATTCTTCCAGGAGTTCCAACAACAATGTGAGGGCATTCATTCT
 
. : . : . : . : . : . :
JMFS009D12+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF033A20+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF020N14+ TTAGAAGATCNTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF022E20+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF048B09+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF049G03+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
JMSF036L14+ TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
                      ____________________________________________________________
consensus TTAGAAGATCCTTGTGAATTGTTATGTTAACACCACCATAAAAAACAGCAACCTTGATAT
 
. : . : . : . : . : . :
JMFS009D12+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
JMSF033A20+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
JMSF020N14+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGGTCTGATAAGCTAATTCTNTGG
JMSF022E20+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGGTCTGATAAGCTAATTCTCTGG
JMSF048B09+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
JMSF049G03+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
JMSF036L14+ CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
                      ____________________________________________________________
consensus CAGGCAAATATGTGCTGAACCTCTCAAATTCATGACAGATCTGATAAGCTAATTCTCTGG
 
. : . : . : . : . : . :
JMFS009D12+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF033A20+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF020N14+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF022E20+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF048B09+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF049G03+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
JMSF036L14+ TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
                      ____________________________________________________________
consensus TATGACATAGAACTAGGGCAGCAACTTGACCAGCAACGGGTTCAATCTGTTGCAAAGTTG
 
. : . : . : . : . : . :
JMFS009D12+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
JMSF033A20+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
JMSF020N14+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTNGGCAAATTACATCCATAC
JMSF022E20+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
JMSF048B09+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
JMSF049G03+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
JMSF036L14+ ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
                      ____________________________________________________________
consensus ATAGAACAAATACTGCAGTTTTCCCCATTCCAGATTTGGCTTGGCAAATTACATCCATAC
 
. : . : . : . : . : . :
JMFS009D12+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
JMSF033A20+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
JMSF020N14+ CCAAAATAGCTTGGGGAANGCATTCATGNTGCACTTCAGATGGATGCTCAAACCNTGAAT
JMSF022E20+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
JMSF048B09+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
JMSF049G03+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
JMSF036L14+ CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
                      ____________________________________________________________
consensus CCAAAATAGCTTGGGGAATGCATTCATGTTGCACTTCAGATGGATGCTCAAACCCTGAAT
 
. : . : . : . : . : . :
JMFS009D12+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF033A20+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF020N14+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF022E20+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF048B09+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF049G03+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
JMSF036L14+ CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
                      ____________________________________________________________
consensus CCACAATGGCTCGCAGTAGCTCTGGCTTTAGTAGAAAATCTCTGAAACCGGAGCTGTGAA
 
. : . : . : . : . : . :
JMFS009D12+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF033A20+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF020N14+ TTCCAATATATCCCTTCTCGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF022E20+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF048B09+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF049G03+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF036L14+ TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
JMSF015H03+ GGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
                      ____________________________________________________________
consensus TTCCAATATATCCCTTCTTGGCGGACTCGCCGTTGACTTTAGCGGCTACGGAATCGGGGG
 
. : . : . : . : . : . :
JMFS009D12+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF033A20+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF020N14+ CTTTTTCGTCT
JMSF022E20+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF048B09+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF049G03+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF036L14+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
JMSF015H03+ CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
                      ____________________________________________________________
consensus CTTTTTCGTCTTCTTCCTCGTAGTCGAGAAGCTCCTCCTCGTAAGCGTCGTTCTCCTTGT
 
. : . : . : . : . : . :
JMFS009D12+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF033A20+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF022E20+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF048B09+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF049G03+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF036L14+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
JMSF015H03+ TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
                      ____________________________________________________________
consensus TTTCTCCCATTTGCTGCTTATTCTAGTCAAATCTGACGATGAACACGAGCTATGCTTTCT
 
. : . : . : . : . : . :
JMFS009D12+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAG
JMSF033A20+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAAT
JMSF022E20+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGA
JMSF048B09+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGATC
JMSF049G03+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGATC
JMSF036L14+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGATC
JMSF015H03+ GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGATC
                      ____________________________________________________________
consensus GAAAAGAACTGGGGTTAGGGTTTGGATTCTGCAGAGAAAAATGTTAGGAAAATTCGGATC