Previous Contig 005545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J15Sequence566005545 (2)gb:AY640380_16189773e-53Lycopersicon esculentum NIM1-like protein 2 (NML2) mRNA, complete cds.162020656
JMSF015G16Sequence542005545 (2)gb:AY640380_16189774e-56Lycopersicon esculentum NIM1-like protein 2 (NML2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001J15+ CTGTCCATTCGATGCAAGATCTGCCACAGACGCTCCATTGTTCAGTAGCCCG
                      ____________________________________________________________
consensus CTGTCCATTCGATGCAAGATCTGCCACAGACGCTCCATTGTTCAGTAGCCCG
 
. : . : . : . : . : . :
JMFF001J15+ AGTATGATCGATGGATCCTTACGTCTAGCAGCTATATGAAGCGCAGTGTATCCTCGTGCA
                      ____________________________________________________________
consensus AGTATGATCGATGGATCCTTACGTCTAGCAGCTATATGAAGCGCAGTGTATCCTCGTGCA
 
. : . : . : . : . : . :
JMFF001J15+ TTAGGAAGATTGGGATCAGCCATACCGAGGTCAAGCACTTCGTTTACGAGCTTAGAGTTG
JMSF015G16+ TG
                      ____________________________________________________________
consensus TTAGGAAGATTGGGATCAGCCATACCGAGGTCAAGCACTTCGTTTACGAGCTTAGAGTTG
 
. : . : . : . : . : . :
JMFF001J15+ CAATAAGCGGCTGCATAGTGAAGAGCATAAGCGTCGTCTAGTGTGACCATAGACTCGTCT
JMSF015G16+ CAATAAGCGGCTGCATAGTGAAGAGCATAAGCGTCGTCTAGTGTGACCATAGACTCGTCT
                      ____________________________________________________________
consensus CAATAAGCGGCTGCATAGTGAAGAGCATAAGCGTCGTCTAGTGTGACCATAGACTCGTCT
 
. : . : . : . : . : . :
JMFF001J15+ AGAAGTAACTTAACCAACTCAACATCATTCGAATCCAGAGCCCTTAAGATTCTCCTGATT
JMSF015G16+ AGAAGTAACTTAACCAACTCAACATCATTCGAATCCAGAGCCCTTAAGATTCTCCTGATT
                      ____________________________________________________________
consensus AGAAGTAACTTAACCAACTCAACATCATTCGAATCCAGAGCCCTTAAGATTCTCCTGATT
 
. : . : . : . : . : . :
JMFF001J15+ CTCTTTTCTTTCAGAGAGTCCACTTGGACAGTGTCCGGTTCAAGATTCCGTTGAAACTTG
JMSF015G16+ CTCTTTTCTTTCAGAGAGTCCACTTGGACAGTGTCCGGTTCAAGATTCCGTTGAAACTTG
                      ____________________________________________________________
consensus CTCTTTTCTTTCAGAGAGTCCACTTGGACAGTGTCCGGTTCAAGATTCCGTTGAAACTTG
 
. : . : . : . : . : . :
JMFF001J15+ AGTCGATTTGCTTTGATGTCACTGAAGACTTCAGGAGGAAGTTCTTTTTCGAGAGTGAAG
JMSF015G16+ AGTCGATTTGCTTTGATGTCACTGAAGACTTCAGGAGGAAGTTCTTTTTCGAGAGTGAAG
                      ____________________________________________________________
consensus AGTCGATTTGCTTTGATGTCACTGAAGACTTCAGGAGGAAGTTCTTTTTCGAGAGTGAAG
 
. : . : . : . : . : . :
JMFF001J15+ TTGTCTAGATCGGATCGTGTCACCCTCTGGACACAACACTCGAGAAGTTGGCTAAGCTCA
JMSF015G16+ TTGTCTAGATCGGATCGTGTCACCCTCTGGACACAACACTCGAGAAGTTGGCTAAGCTCA
                      ____________________________________________________________
consensus TTGTCTAGATCGGATCGTGTCACCCTCTGGACACAACACTCGAGAAGTTGGCTAAGCTCA
 
. : . : . : . : . : . :
JMFF001J15+ CAGTGATAGGCCACCATAAGAATTGGAATCACGTCTTCGATCAGAGCCTTCTCAACAAAG
JMSF015G16+ CAGTGATAGGCCACCATAAGAATTGGAATCACGTCTTCGATCAGAGCCTTCTCAACAAAG
                      ____________________________________________________________
consensus CAGTGATAGGCCACCATAAGAATTGGAATCACGTCTTCGATCAGAGCCTTCTCAACAAAG
 
. : . : . : . : . : . :
JMFF001J15+ TTGTAAAGACGGCGCTGCACAA
JMSF015G16+ TTGTAAAGACGGCGCTGAACAAGCATTTTAAGCTCTTTCATTTGGAAAGTGGAAGAAGCA
                      ____________________________________________________________
consensus TTGTAAAGACGGCGCTGCACAAGCATTTTAAGCTCTTTCATTTGGAAAGTGGAAGAAGCA
 
. : . : . : . : . : . :
JMSF015G16+ TACATGAGCTCAACCGCATAGTTAATGGCGGGGAAGCAAGCGCAATGAACACAAGATTCG
                      ____________________________________________________________
consensus TACATGAGCTCAACCGCATAGTTAATGGCGGGGAAGCAAGCGCAATGAACACAAGATTCG
 
. : . : . : . : . : . :
JMSF015G16+ TCCACACATGTTGAAACCTCGGGAGGAGATCCCTTGAGCTTCCCTGTATACAAATAGTTC
                      ____________________________________________________________
consensus TCCACACATGTTGAAACCTCGGGAGGAGATCCCTTGAGCTTCCCTGTATACAAATAGTTC