Previous Contig 005541:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002L17Sequence469005541 (3)pir|F84675|F846758e-47hypothetical protein At2g27680 [imported] - Arabidopsis thaliana>gb:AC005824_153
JMSF005A12Sequence183005541 (3)
JMSF015F24Sequence477005541 (3)pir|F84675|F846758e-34hypothetical protein At2g27680 [imported] - Arabidopsis thaliana>gb:AC005824_153744011333 (3)gb:AP005558_18540403e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF002L17+ ACTGGTGGTGGCACCCATTTGGTAAGACCTCTGACAGTTTCCAAATATTCTGGGGGTCG
                      ____________________________________________________________
consensus ACTGGTGGTGGCACCCATTTGGTAAGACCTCTGACAGTTTCCAAATATTCTGGGGGTCG
 
. : . : . : . : . : . :
JMFF002L17+ CTCTCGGCGTACTTTGTTGATGAAGATGCCATAAAGATCTTCTGCAGGTCCATAGTGGTC
JMSF015F24+ TCGGCGTACTTTGNTGATGAAGATGCCATAAAGATCTTCTGCAGGTCCATAGTGGTC
                      ____________________________________________________________
consensus CTCTCGGCGTACTTTGTTGATGAAGATGCCATAAAGATCTTCTGCAGGTCCATAGTGGTC
 
. : . : . : . : . : . :
JMFF002L17+ GGCCATGTCGAAAGTGGTGAGACCGGCGTCGGCGTGTTTGAGCATAGCCTCAACGGCGTC
JMSF015F24+ GGCCATGTCGAAAGTGGTGAGACCGGCGTCGGCGTGTTTGAGCATAGCCTCAACGGCGTC
                      ____________________________________________________________
consensus GGCCATGTCGAAAGTGGTGAGACCGGCGTCGGCGTGTTTGAGCATAGCCTCAACGGCGTC
 
. : . : . : . : . : . :
JMFF002L17+ GTTTCGGTCGATTCTGCCCCAGCCACCGCTAGTCTGCCACATACCATTCAGGATTCTACA
JMSF015F24+ GTTTCGGTCGATTCTGCCCCAGCCACCGCTAGTCTGCCACATACCATTCAGGATTCTACA
                      ____________________________________________________________
consensus GTTTCGGTCGATTCTGCCCCAGCCACCGCTAGTCTGCCACATACCATTCAGGATTCTACA
 
. : . : . : . : . : . :
JMFF002L17+ TATATCCAGAGAATCGTTGCCGTTCTTCAGCGTCACCGTCCGGTTCTTCTCCTCCACCAC
JMSF015F24+ TATATCCAGAGAATCGTTGCCGTTCTTCAGCGTCACCGTCCGGTTCTTCTCCTCCACCAC
                      ____________________________________________________________
consensus TATATCCAGAGAATCGTTGCCGTTCTTCAGCGTCACCGTCCGGTTCTTCTCCTCCACCAC
 
. : . : . : . : . : . :
JMFF002L17+ CGCCGTGCAGCACCTCACCGCCACCGCTCCTCTCGGATTCTTCCATCCACCTGCCCGCCG
JMSF005A12+ TCTTCCATCCACCTGCCCGCCG
JMSF015F24+ CGCCGTGCAGCACCTCACCGCCACCGCTCCTCTCGGATTCTTCCATCCACCTGCCCGCCG
                      ____________________________________________________________
consensus CGCCGTGCAGCACCTCACCGCCACCGCTCCTCTCGGATTCTTCCATCCACCTGCCCGCCG
 
. : . : . : . : . : . :
JMFF002L17+ TCGCAGCCCGCCATTTCTAGAGCAGTTCAAGGAGAAGTTATTGGGAGGAAGATTGGGAAT
JMSF005A12+ CCGCAGCCCGCCATTTCTAGAGCAGTTCAAGGAGAAGTTATTGGGAGGAAGATTGGGAAT
JMSF015F24+ CCGCAGCCCGCCATTTCTAGAGCAGTTCAAGGAGAAGTTATTGGGAGGAAGATTGGGAAT
                      ____________________________________________________________
consensus CCGCAGCCCGCCATTTCTAGAGCAGTTCAAGGAGAAGTTATTGGGAGGAAGATTGGGAAT
 
. : . : . : . : . : . :
JMFF002L17+ TGAGTGCCGCAAAGAAAATCCAGTTGCTGCCATTTTACTTTTTTTTTATT
JMSF005A12+ TGAGTGCCGCAAAGAAAATCCAGTTGCTGCCATTTTACTTTTTTTTTATTATTTTTTTCT
JMSF015F24+ TGAGTGCCGCAAAGAAAATCCAGTTGCTGCCATTTTACTTTTTTTTTATTATTTTTTTCT
                      ____________________________________________________________
consensus TGAGTGCCGCAAAGAAAATCCAGTTGCTGCCATTTTACTTTTTTTTTATTATTTTTTTCT
 
. : . : . : . : . : . :
JMSF005A12+ TTTTTAAATGTAAATAAATTGACAGAATCTTAAAGCTCTC
JMSF015F24+ TTTTTAAATGTAAATAAATTGACAGAATCTTAAAGCTCTCAAGTCTCAACCACAATGCCC
                      ____________________________________________________________
consensus TTTTTAAATGTAAATAAATTGACAGAATCTTAAAGCTCTCAAGTCTCAACCACAATGCCC