Previous Contig 005538:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003P07Sequence642005538 (6)gb:AP002487_18222881e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068
JMFS058G09Sequence627005538 (6)gb:AP002487_18222881e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068
JMFS090C12Sequence623005538 (6)
JMSF015F13Sequence585005538 (6)gb:AP002487_18222888e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068764005538 (6)
JMSF022J23Sequence622019260gb:AP002487_18222889e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068779005538 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS090C12+ TATAGAAGTAATACCAACAC
                      ____________________________________________________________
consensus TATAGAAGTAATACCAACAC
 
. : . : . : . : . : . :
JMFS090C12+ TATAACATGTTAAATGTTAAGGAATGCCAATCAAAGCCAATGGCTAATGTCTCCAAATAG
rJMSF015F13- AATAG
rJMSF022J23- AATAG
                      ____________________________________________________________
consensus TATAACATGTTAAATGTTAAGGAATGCCAATCAAAGCCAATGGCTAATGTCTCCAAATAG
 
. : . : . : . : . : . :
JMFS090C12+ TACAAATTAATAAAGGAAGCAGAAATACACAACATGTCAATGGTGAAGAGTTTGGTGATG
rJMSF015F13- TACAAATTAATAAAGGAAGCAGAAATACACAACATGTCAATGGTGAAGAGTTTGGTGATG
rJMSF022J23- TACAAATTAATAAAGGAAGCAGAAATACACAACATGTCAATGGTGAAGAGTTTGGTGATG
                      ____________________________________________________________
consensus TACAAATTAATAAAGGAAGCAGAAATACACAACATGTCAATGGTGAAGAGTTTGGTGATG
 
. : . : . : . : . : . :
JMFS090C12+ AATAAAAAAGCAGTGAACATGTGAATTAGCAGAGAGACCCCTAAGCATCCACTCACTCTG
rJMSF015F13- AATAAAAAAGCAGTGAACATGTGAATTAGCAGAGAGACCCCTAAGCATCCACTCACTCTG
rJMSF022J23- AATAAAAAAGCAGTGAACATGTGAATTAGCAGAGAGACCCCTAAGCATCCACTCACTCTG
                      ____________________________________________________________
consensus AATAAAAAAGCAGTGAACATGTGAATTAGCAGAGAGACCCCTAAGCATCCACTCACTCTG
 
. : . : . : . : . : . :
JMFS090C12+ ACTCATGCTGTTTATTATCATCAGGTTCCTGCTCCTGTTGCTGTTGTTTATGGCTGTTAT
rJMSF015F13- ACTCATGCTGTTTATTATCATCAGGTTCCTGCTCCTGTTGCTGTTGTTTATGGCTGTTAT
rJMSF022J23- ACTCATGCTGTTTATTATCATCAGGTTCCTGCTCCTGTTGCTGTTGTTTATGGCTGTTAT
                      ____________________________________________________________
consensus ACTCATGCTGTTTATTATCATCAGGTTCCTGCTCCTGTTGCTGTTGTTTATGGCTGTTAT
 
. : . : . : . : . : . :
JMFS090C12+ GGCGATGCCCATGACGGTGATGATGATGATGATTCTTCTTGTGCTGCTTCTCGTTCCTGT
rJMSF015F13- GGCGATGCCCATGACGGTGATGATGATGATGATTCTTCTTGTGCTGCTTCTCGTTCCTGT
rJMSF022J23- GGCGATGCCCATGACGGTGATGATGATGATGATTCTTCTTGTGCTGCTTCTCGTTCCTGT
                      ____________________________________________________________
consensus GGCGATGCCCATGACGGTGATGATGATGATGATTCTTCTTGTGCTGCTTCTCGTTCCTGT
 
. : . : . : . : . : . :
JMFS090C12+ CAGATTCATCGATTTCATCACCTGACTTGCTTAGGGATCTACTTCTGTCCCGTTCAGTGT
rJMSF015F13- CAGATTCATCGATTTCATCACCTGACTTGCTTAGGGATCTACTTCTGTCCCGTTCAGTGT
rJMSF022J23- CAGATTCATCGATTTCATCACCTGACTTGCTTAGGGATCTACTTCTGTCCCGTTCAGTGT
JMFN003P07+ TAGGGATCTACTTCTGTCCCGTTCAGTGT
                      ____________________________________________________________
consensus CAGATTCATCGATTTCATCACCTGACTTGCTTAGGGATCTACTTCTGTCCCGTTCAGTGT
 
. : . : . : . : . : . :
JMFS090C12+ CCGATGATGTTGAATCGTGACTGTGAGAGCGGTGGTGGTGATGCTTGCTGCTGCGGTGCC
rJMSF015F13- CCGATGATGTTGAATCGTGACTGTGAGAGCGGTGGTGGTGATGCTTGCTGCTGCGGTGCC
rJMSF022J23- CCGATGATGTTGAATCGTGACTGTGAGAGCGGTGGTGGTGATGCTTGCTGCTGCGGTGCC
JMFN003P07+ CCGATGATGTTGAATCGTGACTGTGAGAGCGGTGGTGGTGATGCTTGCTGCTGCGGTGCC
                      ____________________________________________________________
consensus CCGATGATGTTGAATCGTGACTGTGAGAGCGGTGGTGGTGATGCTTGCTGCTGCGGTGCC
 
. : . : . : . : . : . :
JMFS090C12+ TTCCATGACTACCTCTCTTATGATGGTCCTCATCGGAAGCACTCGAGTCCACTTGCCTGC
rJMSF015F13- TTCCATGACTACCTCTCTTATGATGGTCCTCATCGGAAGCACTCGAGTCCACTTGCCTGC
rJMSF022J23- TTCCATGACTACCTCTCTTATGATGGTCCTCATCGGAAGCACTCGAGTCCACTTGCCTGC
JMFN003P07+ TTCCATGACTACATCTCTTATGATGGTACTCATCGGAAGCACTCGAGTCCACTTGCCTGC
                      ____________________________________________________________
consensus TTCCATGACTACCTCTCTTATGATGGTCCTCATCGGAAGCACTCGAGTCCACTTGCCTGC
 
. : . : . : . : . : . :
JMFS090C12+ GACGCTGATGATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
rJMSF015F13- GACGCTGATGATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
rJMSF022J23- GACGCTGATGATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
JMFN003P07+ GACGCTGATGATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
JMFS058G09+ ATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
                      ____________________________________________________________
consensus GACGCTGATGATGCCTGTGATGCTTAGCGTGGTGTCTTCTTCTCCCAGCACCGTCATCGT
 
. : . : . : . : . : . :
JMFS090C12+ CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
rJMSF015F13- CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
rJMSF022J23- CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
JMFN003P07+ CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
JMFS058G09+ CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
JMSF015F13+ CCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
                      ____________________________________________________________
consensus CATCGCTAGAAGATTCCGAGCCGCCAGAAGAATGTGATCGCCGATGACGCTTGTGATGCT
 
. : . : . : . : . : . :
JMFS090C12+ TTT
rJMSF015F13- TTTTGTGGTGTCGCCTCGTCCCATTGTTGTCATCTTCGTCATCAGAAGAGTGATGATGGT
rJMSF022J23- TTTTGTGGTGTCGCCTCGTCCCATTGTTGTCATCTTCGTCATCAGAAGAGTGATGATGGT
JMFN003P07+ TTTTGTGGTGTCGCCTCGTCCCATTGTTGTCATCTTCGTCATCAGAAGAGTGATGATGGT
JMFS058G09+ TTTTGTGGTGTCGCCTCGTCCCATTGTTGTCATCTTTGTCATCAGAAGAGTGATGATGGT
JMSF015F13+ TTTTGTGGTGTCGCCTCGTCCCATNGTTGTCATCTTCGTCATCAGAAGAGTGATGATGGT
                      ____________________________________________________________
consensus TTTTGTGGTGTCGCCTCGTCCCATTGTTGTCATCTTCGTCATCAGAAGAGTGATGATGGT
 
. : . : . : . : . : . :
rJMSF015F13- GGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTACCGCCATCACTTT
rJMSF022J23- GGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTACCGCCATCACTTT
JMFN003P07+ AGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTGCCGCCATCACTTT
JMFS058G09+ GGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTACCGCCATCACTTT
JMSF015F13+ GGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTACCGCCATCACTTT
                      ____________________________________________________________
consensus GGTGGTGCCTTTTATGCCTCTTGTGAGACCTTTTCACGGCTTTTCTACCGCCATCACTTT
 
. : . : . : . : . : . :
rJMSF015F13- CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
rJMSF022J23- CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
JMFN003P07+ CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
JMFS058G09+ CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
JMSF015F13+ CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
                      ____________________________________________________________
consensus CACCGTCACTATCAGATTCCGAGTCGGATCTCCTCTTGTTCTTTGAAGCTTTCACCTTCT
 
. : . : . : . : . : . :
rJMSF015F13- TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCC
rJMSF022J23- TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCCACCGCTTCA
JMFN003P07+ TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCCACCGCTTCAAGCTTCTCCTCCC
JMFS058G09+ TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCCACCGCTTCAAGCTTCTCCTCCC
JMSF015F13+ TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCCACCGCTTCAAGCTTCTCCTCCC
                      ____________________________________________________________
consensus TCTCTTTGGCTTTAGCATCTGCCCACCCCTTTGCTGCCACCGCTTCAAGCTTCTCCTCCC
 
. : . : . : . : . : . :
JMFN003P07+ ATTTCAACCGAGCTTCGTTCTTCTCCAAAGCCCTCTTCTTTTTCTCCTCCACCAATTGTA
JMFS058G09+ ATTTCAACCGAGCTTCGTTCTTCTCCAAAGCCCTCTTCTTTTTCTCCTCCACCAATTGTA
JMSF015F13+ ATTTCAACCGAGCTTCGTTCTTCTCCAAAGCCCTCTTCTTTTTCTCCTCCACCAATTGTA
                      ____________________________________________________________
consensus ATTTCAACCGAGCTTCGTTCTTCTCCAAAGCCCTCTTCTTTTTCTCCTCCACCAATTGTA
 
. : . : . : . : . : . :
JMFN003P07+ TAAATTTCTTGGCGTCCATTCAAATGCAAATGACAACAAAAATTCT
JMFS058G09+ TAAATTTCTTGGCGTCCATTCAAATGCAAATGACAACAAAAATTCTTGTAACAATTATAT
JMSF015F13+ TAAATTTCTTGGCGTCCATTCAAATGCAAATGACAACAAAAATTCTTGTAACAATTATAT
                      ____________________________________________________________
consensus TAAATTTCTTGGCGTCCATTCAAATGCAAATGACAACAAAAATTCTTGTAACAATTATAT
 
. : . : . : . : . : . :
JMFS058G09+ GAATGCCGAAGAAGTCAAACTTCCCTTATCAAAAGCCAAGCTTCGACTATTCTCTCTCCA
JMSF015F13+ GAATGCCGAAGAAGTCAAACTTCCCTTATCAAAAGCCAAGCTTCGACTATTCTCTCTCCA
                      ____________________________________________________________
consensus GAATGCCGAAGAAGTCAAACTTCCCTTATCAAAAGCCAAGCTTCGACTATTCTCTCTCCA
 
. : . : . : . : . : . :
JMFS058G09+ CACAAGGTTGCACAAATCTTAAGGGAGAAAGAGAGAGACAGATCTGAAGGGGCCGGCGGA
JMSF015F13+ CACAAGGTTGCACAAATCTTAAGGGAGAAAGAGAGAGACAGATCTGAAGGGGCCGGCGGA
                      ____________________________________________________________
consensus CACAAGGTTGCACAAATCTTAAGGGAGAAAGAGAGAGACAGATCTGAAGGGGCCGGCGGA
 
. : . : . : . : . : . :
JMFS058G09+ GAAGAACAGGTTTGACCTTGAATTATTATGGGAAGAA
JMSF015F13+ GAAGAACAGGTTTGACCTTGAATTATTATGGGAAGAATGAAGAGGAGGGTGGTTTGGGCC
                      ____________________________________________________________
consensus GAAGAACAGGTTTGACCTTGAATTATTATGGGAAGAATGAAGAGGAGGGTGGTTTGGGCC