Previous Contig 005535:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B01Sequence222005535 (2)
JMSF015E09Sequence248005535 (2)799022644gb:AB046955_15205533e-22Arabidopsis thaliana APRR5 mRNA for pseudo-response regulator 5, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019B01+ GGCG
                      ____________________________________________________________
consensus GGCG
 
. : . : . : . : . : . :
JMFF019B01+ GCGGCGGCGGGTTTCTGCGCTGTCTGTTTCCCCATTCTTCCCCTGTTTCGCCTCGATTAT
JMSF015E09+ TCGATTAT
                      ____________________________________________________________
consensus GCGGCGGCGGGTTTCTGCGCTGTCTGTTTCCCCATTCTTCCCCTGTTTCGCCTCGATTAT
 
. : . : . : . : . : . :
JMFF019B01+ TTCCATCTGCTCTGTTTCTTGAACTCCCAACTCCGTTCCGCTGCCGCCGTTGGCCTCCGC
JMSF015E09+ TTCCATCTGCTCTGTTTCTTGAACTCCCAACTCCGTTCCGCTGCCGCCGTTGGCCTCCGC
                      ____________________________________________________________
consensus TTCCATCTGCTCTGTTTCTTGAACTCCCAACTCCGTTCCGCTGCCGCCGTTGGCCTCCGC
 
. : . : . : . : . : . :
JMFF019B01+ TTCACCCATTCTCACTAGCAAAGTAAAACAAACCCACCGCTCTTTCCGAGATTGGGTGCT
JMSF015E09+ TTCACCCATTCTCACTAGCAAAGTAAAACAAACCCACCGCTCTTTCCGAGATTGGGTGCT
                      ____________________________________________________________
consensus TTCACCCATTCTCACTAGCAAAGTAAAACAAACCCACCGCTCTTTCCGAGATTGGGTGCT
 
. : . : . : . : . : . :
JMFF019B01+ CCGGTAACAGAAAAAACCAACAGTAGTGTGTCGAAGGT
JMSF015E09+ CCGGTAACAGAAAAAACCAACAGTAGTGTGTCGAAGGTAGTGAAATTCAATGCTGTGTCG
                      ____________________________________________________________
consensus CCGGTAACAGAAAAAACCAACAGTAGTGTGTCGAAGGTAGTGAAATTCAATGCTGTGTCG
 
. : . : . : . : . : . :
JMSF015E09+ TGTCTGGTTTCTCATTGCTTTGCCATCTAAAAATATCTCCGAAATATGAAGGCCCATTTC
                      ____________________________________________________________
consensus TGTCTGGTTTCTCATTGCTTTGCCATCTAAAAATATCTCCGAAATATGAAGGCCCATTTC