Previous Contig 005533:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004K12Sequence576005533 (3)pir|T07370|T073701e-30ubiquinol-cytochrome-c reductase (EC 1.10.2.2) 8.2K chain - potato>gb:STCYTC82_1
JMSF015E04Sequence254005533 (3)pir|T07370|T073701e-07ubiquinol-cytochrome-c reductase (EC 1.10.2.2) 8.2K chain - potato>gb:STCYTC82_1663005533 (3)pir|T07370|T073701e-30ubiquinol-cytochrome-c reductase (EC 1.10.2.2) 8.2K chain - potato>gb:STCYTC82_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004K12+ GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMFN004K12+ CAACAACATTGTTTTCACTTGATAGTTTCACAAGCAACATGTGAATATAAGTATATAAGG
rJMSF015E04- AGG
                      ____________________________________________________________
consensus CAACAACATTGTTTTCACTTGATAGTTTCACAAGCAACATGTGAATATAAGTATATAAGG
 
. : . : . : . : . : . :
JMFN004K12+ TCTCTGGTTCTCACATCAAATTCACAATTAACCTCAACATTAGAGGCCAGAAGAGTTTTA
rJMSF015E04- TCTCTGGTTCTCACATCAAATTCACAATTAACCTCAACATTAGAGGCCAGAAGAGTTTTA
                      ____________________________________________________________
consensus TCTCTGGTTCTCACATCAAATTCACAATTAACCTCAACATTAGAGGCCAGAAGAGTTTTA
 
. : . : . : . : . : . :
JMFN004K12+ AAATGTGATACCACAGTAACCAGACCAAATACAATAAAGCATTAAGCTTATTAAGTTACA
rJMSF015E04- AAATGTGATACCACAGTAACCAGACCAAATACAATAAAGCATTAAGCTTATTAAGTTACA
                      ____________________________________________________________
consensus AAATGTGATACCACAGTAACCAGACCAAATACAATAAAGCATTAAGCTTATTAAGTTACA
 
. : . : . : . : . : . :
JMFN004K12+ GGTAAAGAATAATCACAAGATATCAAAACTTGAACAGTATGACTGATTCTGGTTGCGAAT
rJMSF015E04- GGTAAAGAATAATCACAAGATATCAAAACTTGAACAGTATGACTGATTCTGGTTGCGAAT
                      ____________________________________________________________
consensus GGTAAAGAATAATCACAAGATATCAAAACTTGAACAGTATGACTGATTCTGGTTGCGAAT
 
. : . : . : . : . : . :
JMFN004K12+ CGCATTTGACTTATTTTCGGGTGGAATTTGAATAAAAATGGTTAAATGGGAGCTTTTGCC
rJMSF015E04- CGCATTTGACTTATTTTCGGGTGGAATTTGAATAAAAATGGTTAAATGGGAGCTTTTGCC
                      ____________________________________________________________
consensus CGCATTTGACTTATTTTCGGGTGGAATTTGAATAAAAATGGTTAAATGGGAGCTTTTGCC
 
. : . : . : . : . : . :
JMFN004K12+ AAACATACGAAGTACTTTTGATAGCTAGCTTCAGTATCTGTGAGCTAACTTCTCCTTTTC
rJMSF015E04- AAACATACGAAGTACTTTTGATAGCTAGCTTCAGTATCTGTGAGCTAACTTCTCCTTTTC
                      ____________________________________________________________
consensus AAACATACGAAGTACTTTTGATAGCTAGCTTCAGTATCTGTGAGCTAACTTCTCCTTTTC
 
. : . : . : . : . : . :
JMFN004K12+ CTGGTATTGCTGCACATATGTGTAGACGCCGACGAGAGGACCGAGGAGGAGGGAGGCGCT
rJMSF015E04- CTGGTATTGCTGCACATATGTGTAGACGCCGACGAGAGGACCGAGGAGGAGGGAGGCGCT
                      ____________________________________________________________
consensus CTGGTATTGCTGCACATATGTGTAGACGCCGACGAGAGGACCGAGGAGGAGGGAGGCGCT
 
. : . : . : . : . : . :
JMFN004K12+ GATCCAGTTCTCGGAGACCTTGTGGTTGATCTTACCGGGAAGGTCCTTCCAAAGTCCAGG
rJMSF015E04- GATCCAGTTCTCGGAGACCTTGTGGTTGATCTTACCGGGAAGGTCCTTCCAAAGTCCAGG
JMSF015E04+ TTCCAAAGTCCAGG
                      ____________________________________________________________
consensus GATCCAGTTCTCGGAGACCTTGTGGTTGATCTTACCGGGAAGGTCCTTCCAAAGTCCAGG
 
. : . : . : . : . : . :
JMFN004K12+ CATCACCTTCTGCTGGAACGGCGATAGCGCGTAAACAACAGCCTTCAACCTCACTGGCTG
rJMSF015E04- CATCACCTTCTGCTGGAACGGCGATAGCGCGTAAACAACAGCCTTCAACCTCACTGGCTG
JMSF015E04+ CATCACCTTCTGCTGGAACGGCGATAGCGCGTAAACAACAGCCTTCAACCTCACTGGCTG
                      ____________________________________________________________
consensus CATCACCTTCTGCTGGAACGGCGATAGCGCGTAAACAACAGCCTTCAACCTCACTGGCTG
 
. : . : . : . : . : . :
JMFN004K12+ CTTCCCCAT
rJMSF015E04- CTTCCCCATATCCTCAAACTGCAATCTCTTCTTCTTCTTCTTCTTCTTTGGGTTGCGCGG
JMSF015E04+ CTTCCCCATATCCTCAAACTGCAATCTCTTCTTCTTCTTCTTCTTCTTTGGGTTGCGCGG
                      ____________________________________________________________
consensus CTTCCCCATATCCTCAAACTGCAATCTCTTCTTCTTCTTCTTCTTCTTTGGGTTGCGCGG
 
. : . : . : . : . : . :
rJMSF015E04- TGTGCTAGGGCTTCAGATCGTTGAGAAGAAAATGGAAGGTTCTCATCGCCTACGAATATG
JMSF015E04+ TGTGCTAGGGCTTCAGATCGTTGAGAAGAAAATGGAAGGTTCTCATCGCCTACGAATATG
                      ____________________________________________________________
consensus TGTGCTAGGGCTTCAGATCGTTGAGAAGAAAATGGAAGGTTCTCATCGCCTACGAATATG
 
. : . : . : . : . : . :
rJMSF015E04- AACAGAACAGATGAAGTAGCCACCGCTGAGGAAATCTTCCATAGGACTCGGTCCTCCGCC
JMSF015E04+ AACAGAACAGATGAAGTAGCCACCGCTGAGGAAATCTTCCATAGGACTCGGTCCTCCGCC
                      ____________________________________________________________
consensus AACAGAACAGATGAAGTAGCCACCGCTGAGGAAATCTTCCATAGGACTCGGTCCTCCGCC