Previous Contig 005530:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS011D05Sequence455005530 (4)
JMFS108E02Sequence277005530 (4)
JMFS108G01Sequence597005530 (4)gb:AY643519_16191615e-33Acacia mangium CesA1 mRNA, complete cds.
JMSF015D21Sequence255005530 (4)736011816 (36)gb:ATAC002343_15427848e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS108G01+ GAGACTCATGC
                      ____________________________________________________________
consensus GAGACTCATGC
 
. : . : . : . : . : . :
JMFS108G01+ CTTGAGAAGAAGAGAGATCCACATCTTCTCCCTGCCACTGGTGTCTAGCCTTGCTATTCC
                      ____________________________________________________________
consensus CTTGAGAAGAAGAGAGATCCACATCTTCTCCCTGCCACTGGTGTCTAGCCTTGCTATTCC
 
. : . : . : . : . : . :
JMFS108G01+ CCTGGGCATGATTAAACTCATCATCCAGGTCATCAGAATAATCTTCCTCATCATCCCCAT
                      ____________________________________________________________
consensus CCTGGGCATGATTAAACTCATCATCCAGGTCATCAGAATAATCTTCCTCATCATCCCCAT
 
. : . : . : . : . : . :
JMFS108G01+ CAACCCGTGGACTCCCTTTTTGTCTCTTGTATCTAGTTTTGCACTGGGGACATGCTTGAT
                      ____________________________________________________________
consensus CAACCCGTGGACTCCCTTTTTGTCTCTTGTATCTAGTTTTGCACTGGGGACATGCTTGAT
 
. : . : . : . : . : . :
JMFS108G01+ TTCCATCTTTGCGCTCATACTCATAACAAGGCCGGCAAACAGGGAAGGCACACTCATTAC
                      ____________________________________________________________
consensus TTCCATCTTTGCGCTCATACTCATAACAAGGCCGGCAAACAGGGAAGGCACACTCATTAC
 
. : . : . : . : . : . :
JMFS108G01+ ACGCAACAAATGCATCACCACTAGCAGTCACCCCAACAGCATCACCACAAATCTGACATA
                      ____________________________________________________________
consensus ACGCAACAAATGCATCACCACTAGCAGTCACCCCAACAGCATCACCACAAATCTGACATA
 
. : . : . : . : . : . :
JMFS108G01+ TCTGACTACTCCCCCCCCCCCCCTACCCATCTCTCTCTCTACCTATATGTACAGGTGTGT
JMFS011D05+ CCCCCCCCCCCCCTACCCATCTCTCTCTCTACCTATATGTACAGGTGTGT
JMSF015D21+ TATGTACAGGTGTGT
                      ____________________________________________________________
consensus TCTGACTACTCCCCCCCCCCCCCTACCCATCTCTCTCTCTACCTATATGTACAGGTGTGT
 
. : . : . : . : . : . :
JMFS108G01+ GTATGTATAGGTGTAACAGATTGTATAGAAAGTGCAGAGAGATGATGGTCTGTAGTGTTC
JMFS011D05+ GTATGTATAGGTGTAACAGATTGTATAGAAAGTGCAGAGAGATGATGGTCTGTAGTGTTC
JMSF015D21+ GTATGTATAGGTGTAACAGATTGTATAGAAAGTGCAGAGAGATGATGGTCTGTAGTGTTC
                      ____________________________________________________________
consensus GTATGTATAGGTGTAACAGATTGTATAGAAAGTGCAGAGAGATGATGGTCTGTAGTGTTC
 
. : . : . : . : . : . :
JMFS108G01+ TCTTTTTCTTCTCACTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAAC
JMFS108E02+ CTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAAC
JMFS011D05+ TCTTTTTCTTCTCACTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAAC
JMSF015D21+ TCTTTTTCTTCTCACTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAAC
                      ____________________________________________________________
consensus TCTTTTTCTTCTCACTTTTTTCAGTTACAAAACCACTCTCGGCTGTGTCTTCTCAGCAAC
 
. : . : . : . : . : . :
JMFS108G01+ AAAACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTT
JMFS108E02+ AAAACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTT
JMFS011D05+ AAAACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTT
JMSF015D21+ AAAACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTT
                      ____________________________________________________________
consensus AAAACCACTTTCCTGGGGGAAAAAACCGCTTTTTCTTCTTGGCTTTTAATTTCTTCTCTT
 
. : . : . : . : . : . :
JMFS108G01+ CGTGTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACC
JMFS108E02+ CGTGTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACC
JMFS011D05+ CGTGTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAA
JMSF015D21+ CGTGTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAATCCCAAAACCC
                      ____________________________________________________________
consensus CGTGTATGGAGAAGAGCAACAACAACTGAACGCAGTCCACGTTACCGAATCCCAAAACCC