Previous Contig 005529:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015D16Sequence510005529 (2)752011814 (3)gb:AB017071_15134861e-80Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163
JMSF030L11Sequence625005529 (2)gb:AB017071_15134868e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163751011814 (3)gb:AB017071_15134861e-80Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT002047_163

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030L11+ CTTTGCTGGCACTGATGAGGAAAAAT
                      ____________________________________________________________
consensus CTTTGCTGGCACTGATGAGGAAAAAT
 
. : . : . : . : . : . :
JMSF030L11+ CCNTCAGGAGTGATGGGGCTGTAGAACAAATCAACAACCGGCCGGGAATGCCCGTGGCAA
                      ____________________________________________________________
consensus CCNTCAGGAGTGATGGGGCTGTAGAACAAATCAACAACCGGCCGGGAATGCCCGTGGCAA
 
. : . : . : . : . : . :
JMSF030L11+ ACAAGCGGAGCGGCAACCTTNTTATCCATCAAACAATATTCCTAATTGCCCCCAGAATAT
JMSF015D16+ ATCAANCAATATTCCTAATTGCCCCCAGAATAT
                      ____________________________________________________________
consensus ACAAGCGGAGCGGCAACCTTNTTATCCATCAAACAATATTCCTAATTGCCCCCAGAATAT
 
. : . : . : . : . : . :
JMSF030L11+ AAATATGCTAAAAAAAAAATACTTTCTTTCCTCTTTCGATCAAATATGCTATAAATAAGA
JMSF015D16+ AAATATGCT-AAAAAAAAATACTTTCTTTCCTCTTT--ATCAAATATGCTATAAATAAGA
                      ____________________________________________________________
consensus AAATATGCTAAAAAAAAAATACTTTCTTTCCTCTTTCGATCAAATATGCTATAAATAAGA
 
. : . : . : . : . : . :
JMSF030L11+ TACTAGCAAAATCAAAATCAACGCGGCCAAGTCCCAGATCCGAATTTCATAAAACAAGGA
JMSF015D16+ TACTAGCAAAATCAAAATCAACGCGGCCAAGTCCCAGATCCGAATTTCATAAAACAAGGA
                      ____________________________________________________________
consensus TACTAGCAAAATCAAAATCAACGCGGCCAAGTCCCAGATCCGAATTTCATAAAACAAGGA
 
. : . : . : . : . : . :
JMSF030L11+ ACGGCAAAAACAGCACCAACTGACAATTGAACAAAAAATACGCACAATTGCCTGCACAAA
JMSF015D16+ ACGGCAAAAACAGCACCAACTGACAATTGAACAAAAAATACGCACAATTGCCTGCACAAA
                      ____________________________________________________________
consensus ACGGCAAAAACAGCACCAACTGACAATTGAACAAAAAATACGCACAATTGCCTGCACAAA
 
. : . : . : . : . : . :
JMSF030L11+ ATCCAAACTTTATATGCTGATTTTTGTTCTTTGATGTGTTTATCCACTGTATAGAAGAAA
JMSF015D16+ ATCCAAACTTTATATGCTGATTTTTGTTCTTTGATGTGTTTATCCACTGTATAGAAGAAA
                      ____________________________________________________________
consensus ATCCAAACTTTATATGCTGATTTTTGTTCTTTGATGTGTTTATCCACTGTATAGAAGAAA
 
. : . : . : . : . : . :
JMSF030L11+ ATTGCAAATTAAAATGTAAAATTTTCTACAGATCAGATATAGATAAGGAAATGGATATGT
JMSF015D16+ ATTGCAAATTAAAATGTAAAATTTTCTACAGATCAGATATAGATAAGGAAATGGATATGT
                      ____________________________________________________________
consensus ATTGCAAATTAAAATGTAAAATTTTCTACAGATCAGATATAGATAAGGAAATGGATATGT
 
. : . : . : . : . : . :
JMSF030L11+ GTATTAGGGAGATTGGCGCGACAATCAACAAGGTGGGAAACCCTAAATTGGGATTCGATC
JMSF015D16+ GTATTAGGGAGATTGGCGCGACAATCAACAAGGTGGGAAACCCTAAATTGGGATTCGATC
                      ____________________________________________________________
consensus GTATTAGGGAGATTGGCGCGACAATCAACAAGGTGGGAAACCCTAAATTGGGATTCGATC
 
. : . : . : . : . : . :
JMSF030L11+ GGTTTGAGTTCTGAGTGAATTCACACCTCCAACCCTAGAAGATTGATAGATCAGAGAGAA
JMSF015D16+ GGTTTGAGTTCTGAGTGAATTCACACCTCCAACCCTAGAAGATTGATAGATCAGAGAGAA
                      ____________________________________________________________
consensus GGTTTGAGTTCTGAGTGAATTCACACCTCCAACCCTAGAAGATTGATAGATCAGAGAGAA
 
. : . : . : . : . : . :
JMSF030L11+ AAAAACAAAAG-AAAAAAATATAGTAATATACAACTACACTACAGGGCTGGCTGGG
JMSF015D16+ AAAAACAAAAGAAAAAAAATATAGTAATATACAACTACACTACAGGGCTGGCTGGGTGCC
                      ____________________________________________________________
consensus AAAAACAAAAGAAAAAAAATATAGTAATATACAACTACACTACAGGGCTGGCTGGGTGCC