Previous Contig 005524:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003G12Sequence551005524 (7)gb:AJ875407_18151156e-12Glycine max mRNA for N-rich protein (nrp gene).
JMFF041C21Sequence607005524 (7)gb:AJ875407_18151157e-12Glycine max mRNA for N-rich protein (nrp gene).552005524 (7)sp|P37707|B2_DAUCA2e-34B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA
JMSF015C12Sequence505005524 (7)gb:AJ875407_18151155e-12Glycine max mRNA for N-rich protein (nrp gene).781005524 (7)gb:AY080773_15684771e-83Arabidopsis thaliana unknown protein (At5g42050) mRNA, complete cds.>gb:AY088465
JMSF016C12Sequence503005524 (7)gb:AJ875407_18151155e-12Glycine max mRNA for N-rich protein (nrp gene).617005524 (7)sp|P37707|B2_DAUCA8e-62B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041C21- AATCAAACGAGAGATAGGACATTTATTTTTCATTATGTT
                      ____________________________________________________________
consensus AATCAAACGAGAGATAGGACATTTATTTTTCATTATGTT
 
. : . : . : . : . : . :
rJMFF041C21- TAGTATAGTACTGTATGTGTGGCATTATTGCCATGTAAAAGGATGACTTATACAACATTA
                      ____________________________________________________________
consensus TAGTATAGTACTGTATGTGTGGCATTATTGCCATGTAAAAGGATGACTTATACAACATTA
 
. : . : . : . : . : . :
rJMFF041C21- TATAAGCTCCTAAAAGAGAAAACAAAAACACAACACACAAACATCATTACTTTGAGGTTT
                      ____________________________________________________________
consensus TATAAGCTCCTAAAAGAGAAAACAAAAACACAACACACAAACATCATTACTTTGAGGTTT
 
. : . : . : . : . : . :
rJMFF041C21- CCAGCAACAGGGCAAGCTTCTTAGATCAGTCTTGGTTATGTCACAAGACTGTTCTTCTAC
                      ____________________________________________________________
consensus CCAGCAACAGGGCAAGCTTCTTAGATCAGTCTTGGTTATGTCACAAGACTGTTCTTCTAC
 
. : . : . : . : . : . :
rJMFF041C21- CTGCTGCAAAACATAATTAATCTTCTGTTTGTTTTTTCGGTTTAACATGCTTTTCGACTG
                      ____________________________________________________________
consensus CTGCTGCAAAACATAATTAATCTTCTGTTTGTTTTTTCGGTTTAACATGCTTTTCGACTG
 
. : . : . : . : . : . :
rJMFF041C21- TTCATCTTCGGTTGTATAATTCTGTCTTTAGACTTTAGGGGTTGTTCTCCGCGAAAATAT
rJMSF015C12- TCTCCGCGAAAATAT
                      ____________________________________________________________
consensus TTCATCTTCGGTTGTATAATTCTGTCTTTAGACTTTAGGGGTTGTTCTCCGCGAAAATAT
 
. : . : . : . : . : . :
rJMFF041C21- CCAAAAGAGATAGGGTCTCAGGAATGTTTAACTCAAGGCGGAATTTAGGTCCGTCGTAGT
rJMSF015C12- CCAAAAGAGATAGGGTCTCAGGAATGTTTAACTCAAGGCGGAATTTAGGTCCGTCGTAGT
                      ____________________________________________________________
consensus CCAAAAGAGATAGGGTCTCAGGAATGTTTAACTCAAGGCGGAATTTAGGTCCGTCGTAGT
 
. : . : . : . : . : . :
rJMFF041C21- GGTGAAGAATAGGCCTGAAAGCATCCTCTTCGAGTGGTTCACACACTTTTCTCGTGACAA
rJMSF016C12- GGCCNGAAAGCATCCTCTTCGAGNGGNTCACACACTTTTCTCGTGACAA
rJMSF015C12- GGTGAAGAATAGGCCTGAAAGCATCCTCTTCGAGTGGTTCACACACTTTTCTCGTGACAA
                      ____________________________________________________________
consensus GGTGAAGAATAGGCCTGAAAGCATCCTCTTCGAGTGGTTCACACACTTTTCTCGTGACAA
 
. : . : . : . : . : . :
rJMFF041C21- CACGCACCTGAGCAGGGAAACGCGATTCACCAGGGTTCTTCTTGTCCTCCCAGGCCGAAG
rJMSF016C12- CACGCACCTGAGCAGGGAAACGCGATTCACCAGGGTTCTTCTTGTCCTCCCAGGCCGAAG
rJMSF015C12- CACGCACCTGAGCAGGGAAACGCGATTCACCAGGGTTCTTCTTGTCCTCCCAGGCCGAAG
                      ____________________________________________________________
consensus CACGCACCTGAGCAGGGAAACGCGATTCACCAGGGTTCTTCTTGTCCTCCCAGGCCGAAG
 
. : . : . : . : . : . :
rJMFF041C21- GATCAATGTTTGTGCCACCGAAGCT
rJMSF016C12- GATCAATGTTTGTGCCACCGAANCTCGCTGCCTCAAAAATACCATGAAGCTGATGAGTTG
rJMSF015C12- GATCAATGTTTGTGCCACCGAAGCTCGCTGCCTCAAAAATACCATGAAGCTGATGAGTTG
                      ____________________________________________________________
consensus GATCAATGTTTGTGCCACCGAAGCTCGCTGCCTCAAAAATACCATGAAGCTGATGAGTTG
 
. : . : . : . : . : . :
rJMSF016C12- AGTACTNGTANAGGAAAANAGGCAATCCTGGTGTTATTTGCCTGACCGAATCGCGATAAC
rJMSF015C12- AGTAGTTGTAGAGGAAAAGAGGCAATCCTGGTGTTATTTGCCTGACCGAATCGCGATAAC
                      ____________________________________________________________
consensus AGTAGTTGTAGAGGAAAAGAGGCAATCCTGGTGTTATTTGCCTGACCGAATCGCGATAAC
 
. : . : . : . : . : . :
rJMSF016C12- GAGGTGGCAAGCCAAATAGCTGCCTTCTGAGATTTTCTTCCATGGTGTCATTGTTGCAGA
rJMSF015C12- GAGGTGGCAAGCCAAATAGCTGCCTTCTGAGATTTTCTTCCATGGTGTCATTGTTGCAGA
                      ____________________________________________________________
consensus GAGGTGGCAAGCCAAATAGCTGCCTTCTGAGATTTTCTTCCATGGTGTCATTGTTGCAGA
 
. : . : . : . : . : . :
rJMSF016C12- CAAAAATATATCCTCCAACCGTCTCGTTTCTGGNCAGAGCTTCTGAAGGCGGNAAAGTCT
rJMSF015C12- CAAAAATATATCCTCCAACCGTCTCGTTTCTGGGCAGAGCTTCTGAAGGCGGCAAAGTCT
JMFF041C21+ AAAGTCT
                      ____________________________________________________________
consensus CAAAAATATATCCTCCAACCGTCTCGTTTCTGGGCAGAGCTTCTGAAGGCGGCAAAGTCT
 
. : . : . : . : . : . :
rJMSF016C12- TGAACCTCTTATCAACTCCATTCTTGTCAGAAATATCTTTGTTAACATTCTTGTTCTTCT
rJMSF015C12- TGAACCTCTTATCAACTCCATTCTTGTCAGAAATATCTTTGTTAACATTCTTGTTCTTCT
JMFF041C21+ TGAACCTCTTATCAACTCCATTCTTGTCAGAAATATCTTTGTTAACATTCTTGTTCTTCT
JMFF003G12+ TCTTGTTCTTCT
                      ____________________________________________________________
consensus TGAACCTCTTATCAACTCCATTCTTGTCAGAAATATCTTTGTTAACATTCTTGTTCTTCT
 
. : . : . : . : . : . :
rJMSF016C12- TCCCACATTTCTCATCTTCTAACCCAAACTTCCCACCCTTCTTGTTATTAATCCCTTTAC
rJMSF015C12- TCCCACATTTCTCATCTTCTAACCCAAACTTCCCACCCTTCTTGTTATTAATCCCTTTAC
JMFF041C21+ TCCCACATTTCTCATCTTCTAACCCAAACTTCCCACCCTTCTTGTTATTAATCCCTTTAC
JMFF003G12+ TCCCACATTTCTCATCTTCTAACCCAAACTTCCCACCCTTCTTGTTATTAATCCCTTTAC
JMSF016C12+ CTTCTTGTTATTAATCCCTTTAC
JMSF015C12+ CCCTTCTTGTTATTAATCCCTTTAC
                      ____________________________________________________________
consensus TCCCACATTTCTCATCTTCTAACCCAAACTTCCCACCCTTCTTGTTATTAATCCCTTTAC
 
. : . : . : . : . : . :
rJMSF016C12- TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGN
rJMSF015C12- TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
JMFF041C21+ TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
JMFF003G12+ TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
JMSF016C12+ TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
JMSF015C12+ TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
                      ____________________________________________________________
consensus TATTCACCACCGCCAGATTACCAGTACCCTTACTGTAAGAATTGAAGTTGACAGCAGGGG
 
. : . : . : . : . : . :
rJMSF016C12- AAGGGTAAATCCCCTTGTTAAACCCGCCATTCNANCCGGATCCANACACCTCCTTGGGAG
rJMSF015C12- AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
JMFF041C21+ AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
JMFF003G12+ AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
JMSF016C12+ AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
JMSF015C12+ AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
                      ____________________________________________________________
consensus AAGGGTAAATCCCCTTGTTAAACCCGCCATTCAACCCGGATCCAAACACCTCCTTGGGAG
 
. : . : . : . : . : . :
rJMSF016C12- CAGACCCNGAGAGAGAACTGACAG
rJMSF015C12- CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
JMFF041C21+ CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
JMFF003G12+ CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
JMSF016C12+ CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
JMSF015C12+ CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
                      ____________________________________________________________
consensus CAGACCCAGAGAGAGAACTGACAGTTTGGGTGACCTTCCAGCCATCGTTGCCGAAGAGAG
 
. : . : . : . : . : . :
rJMSF015C12- CGTAATCGGCGGCGTCAG
JMFF041C21+ CGTAATCGGCGGCGTCAGAATTGACCTCCAAGTTCCTCCGCTCCTCGGGGCGCTTGGAGG
JMFF003G12+ CGTAATCGGCGGCGTCAGAATTGACCTCCAAGTTCCTCCGCTCCTCGGGGCGCTTGGAGG
JMSF016C12+ CGTAATCGGCGGCGTCAGAATTGACCTCCAAGTTCCTCCGCTCCTCGGGGCGCTTGGAGG
JMSF015C12+ CGTAATCGGCGGCGTCAGAATTGACCTCCAAGTTCCTCCGCTCCTCGGGGCGCTTGGAGG
                      ____________________________________________________________
consensus CGTAATCGGCGGCGTCAGAATTGACCTCCAAGTTCCTCCGCTCCTCGGGGCGCTTGGAGG
 
. : . : . : . : . : . :
JMFF041C21+ AGTAGCTGGTGCTCCAGATGGAGTCGTTGAGGGAGAGATTGGTGAAGGTGCCCGGTTGCA
JMFF003G12+ AGTAGCTGGTGCTCCAGATGGAGTCGTTGAGGGAGAGATTGGTGAAGGTGCCCGGTTGCA
JMSF016C12+ AGTAGCTGGTGCTCCAGATGGAGTCGTTGAGGGAGAGATTGGTGAAGGTGCCCGGTTGCA
JMSF015C12+ AGTAGCTGGTGCTCCAGATGGAGTCGTTGAGGGAGAGATTGGTGAAGGTGCCCGGTTGCA
                      ____________________________________________________________
consensus AGTAGCTGGTGCTCCAGATGGAGTCGTTGAGGGAGAGATTGGTGAAGGTGCCCGGTTGCA
 
. : . : . : . : . : . :
JMFF041C21+ GGCGGAGGCGGTCGCTGAAGTTCCTGAAAGATGATTGAGCGTTCTCCATTTCTGCAACAA
JMFF003G12+ GGCGGAGGCGGTCGCTGAAGTTCCTGAAAGATGATTGAGCGTTCTCCATTTCTGCAACAA
JMSF016C12+ GGCGGAGGCGGTCGCTGAAGTTCCTGAAAGATGATTGAGCGTTCTCCATTTCTGCAACAA
JMSF015C12+ GGCGGAGGCGGTCGCTGAAGTTCCTGAAAGATGATTGAGCGTTCTCCATTTCTGCAACAA
                      ____________________________________________________________
consensus GGCGGAGGCGGTCGCTGAAGTTCCTGAAAGATGATTGAGCGTTCTCCATTTCTGCAACAA
 
. : . : . : . : . : . :
JMFF041C21+ GTTTCAGGCTTGAGTTCTTCTGTTGAGAGTTGAAGAAGAGAGAAAGAGAGAGAAAGAGAG
JMFF003G12+ GTTTCAGGCTTGAGTTCTTCTGTTGAGAGTTGAAGAAGAGAGAAAGAGAGAGAAAGAGAG
JMSF016C12+ GTTTCAGGCTTGAGTTCTTCTGTTGAGAGTTGAAGAAGAGAGAAAGAGAGAGAAAGAGAG
JMSF015C12+ GTTTCAGGCTTGAGTTCTTCTGTTGAGAGTTGAAGAAGAGAGAAAGAGAGAGAAAGAGAG
                      ____________________________________________________________
consensus GTTTCAGGCTTGAGTTCTTCTGTTGAGAGTTGAAGAAGAGAGAAAGAGAGAGAAAGAGAG
 
. : . : . : . : . : . :
JMFF041C21+ AGAGATGAAGAAGTGAGAAATGAGAATGGGTGAACGTGTTGATGAGTGGCGTGTTGGGT
JMFF003G12+ AGAGATGAAGAAGTGAGAAATGAGAATGGGTGAACGTGTTGATGAGTGGCGTGTTGGGT
JMSF016C12+ AGAGATGAAGAAGTGAGAAATGAGAATGGGTGAACGTGTTGATGAGTGGCGTGTTGGGT
JMSF015C12+ AGAGATGAAGAAGTGAGAAATGAGAATGGGTGAACGTGTTGATGAGTGGCGTGTTGGGTC
                      ____________________________________________________________
consensus AGAGATGAAGAAGTGAGAAATGAGAATGGGTGAACGTGTTGATGAGTGGCGTGTTGGGTC