Previous Contig 005523:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004K21Sequence367005523 (8)gb:NRPHOSLPC_16911573e-25N.rustica mRNA for phosphoinositide-specific phospholipase C.736010915 (7)gb:NRY11931_16911636e-82N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.
JMFF021J16Sequence574005523 (8)gb:NRPHOSLPC_16911573e-71N.rustica mRNA for phosphoinositide-specific phospholipase C.738010915 (7)gb:NRY11931_16911635e-80N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.
JMFF027L14Sequence509005523 (8)gb:NRPHOSLPC_16911577e-50N.rustica mRNA for phosphoinositide-specific phospholipase C.733010915 (7)gb:NRY11931_16911636e-82N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.
JMFF048O09Sequence600005523 (8)gb:NRPHOSLPC_16911576e-74N.rustica mRNA for phosphoinositide-specific phospholipase C.512010915 (7)gb:NRPHOSLPC_16911572e-59N.rustica mRNA for phosphoinositide-specific phospholipase C.
JMFF049I17Sequence545005523 (8)gb:NRPHOSLPC_16911572e-58N.rustica mRNA for phosphoinositide-specific phospholipase C.581010915 (7)gb:NRPHOSLPC_16911572e-43N.rustica mRNA for phosphoinositide-specific phospholipase C.
JMSF015C10Sequence227005523 (8)751010915 (7)gb:NRY11931_16911636e-89N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.
JMSF033M17Sequence675005523 (8)gb:NRPHOSLPC_16911573e-94N.rustica mRNA for phosphoinositide-specific phospholipase C.708010915 (7)gb:NRY11931_16911634e-85N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.
JMSF050O21Sequence621005523 (8)gb:NRPHOSLPC_16911573e-61N.rustica mRNA for phosphoinositide-specific phospholipase C.752024443gb:NRY11931_1691163e-100N.rustica mRNA for 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033M17+ TCTTCCAGTGTTATTACAACTGGG
                      ____________________________________________________________
consensus TCTTCCAGTGTTATTACAACTGGG
 
. : . : . : . : . : . :
JMSF033M17+ TAGGGAGAGGCAACAAAGGCATTCTCCTTTATTGACTTCAGACATTTTATGAGTTCCACA
                      ____________________________________________________________
consensus TAGGGAGAGGCAACAAAGGCATTCTCCTTTATTGACTTCAGACATTTTATGAGTTCCACA
 
. : . : . : . : . : . :
JMSF033M17+ GGAGTTGTCACTGTCCTTCCATGAAGAACAATCACATCATCCTTTGCTGAGTTTGGCCAT
JMFF048O09+ GAAGAACAATCACATCATCCTNTGCTGAGTTGGGCCAT
JMFF021J16+ GGCCAT
                      ____________________________________________________________
consensus GGAGTTGTCACTGTCCTTCCATGAAGAACAATCACATCATCCTTTGCTGAGTTTGGCCAT
 
. : . : . : . : . : . :
JMSF033M17+ ATATCAAGCTCTATAACCCTTACACCTCTCTTCAGTGCCTTAATTATTGGAACATCACTG
JMFF048O09+ ATATCAAGCTCTATAACCCTTACACCTCTCTTCAGTGCCTTAATTATTGGAACATCACTG
JMFF021J16+ ATATCAAGCTCTATAACCCTTACACCTCTCTTCAGTGCCTTAATTATTGGAACATCACTG
JMFF049I17+ CTG
JMSF050O21+ TTAATTATTGGAACATCACTG
                      ____________________________________________________________
consensus ATATCAAGCTCTATAACCCTTACACCTCTCTTCAGTGCCTTAATTATTGGAACATCACTG
 
. : . : . : . : . : . :
JMSF033M17+ CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
JMFF048O09+ CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
JMFF021J16+ CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
JMFF049I17+ CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
JMFF027L14+ GAATTATGCCCAGTGAATATATAATAA
JMSF050O21+ CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
                      ____________________________________________________________
consensus CAATCACTTGTCAGCTGATTTCCAGTCAAGTACGAATTATGCCCAGTGAATATATAATAA
 
. : . : . : . : . : . :
JMSF033M17+ TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
JMFF048O09+ TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
JMFF021J16+ TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
JMFF049I17+ TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
JMFF027L14+ TGGGATAAGGGAGCTGTCATATCATGANGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
JMSF050O21+ TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
                      ____________________________________________________________
consensus TGGGATAAGGGAGCTGTCATATCATGATGAACCTTTGAAATGATTGGGGGGTTGAGGTCG
 
. : . : . : . : . : . :
JMSF033M17+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
JMFF048O09+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
JMFF021J16+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
JMFF049I17+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
JMFF027L14+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
JMFF004K21+ TGGAA
JMSF050O21+ GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
                      ____________________________________________________________
consensus GCGTTGAAGAGGAAATGGTGGAAATCGTCGAGAGCGAGATTGCGACGAGTTAACTTGGAA
 
. : . : . : . : . : . :
JMSF033M17+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMFF048O09+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMFF021J16+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMFF049I17+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMFF027L14+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMFF004K21+ ATGGGGTGGCGTTTGTGGAGGATCTGNTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
JMSF050O21+ ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
                      ____________________________________________________________
consensus ATGGGGTGGCGTTTGTGGAGGATCTGCTGCACGATCGCTTCCGCCTCCGCGAGAGTGGCT
 
. : . : . : . : . : . :
JMSF033M17+ TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMFF048O09+ TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMFF021J16+ TCCTTTTGTCCCTGCTACTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMFF049I17+ TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMFF027L14+ TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMFF004K21+ TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
JMSF050O21+ TCCTTTTGTCCCTGCTCCTCCGTGATGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
                      ____________________________________________________________
consensus TCCTTTTGTCCCTGCTCCTCCGTGAGGAAGCGCAGCAGCTGCTCCGAGCTCATCTGGCTC
 
. : . : . : . : . : . :
JMSF033M17+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMFF048O09+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMFF021J16+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMFF049I17+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMFF027L14+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMFF004K21+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
JMSF050O21+ CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
                      ____________________________________________________________
consensus CCTTCCTCCGCATACTTCTTGAACGCCTCCTTCACGTCCGCCGCCGGCTGCGCCTCCGTC
 
. : . : . : . : . : . :
JMSF033M17+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATC--GA
JMFF048O09+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMFF021J16+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMFF049I17+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMFF027L14+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMFF004K21+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMSF050O21+ ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
JMSF015C10+ TCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
                      ____________________________________________________________
consensus ACCTTAAACTTCCTCGTGAAACACATACAAACTCTGTAACTCCCCATTCCCAAATCCAAA
 
. : . : . : . : . : . :
JMSF033M17+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTC
JMFF048O09+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMFF021J16+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMFF049I17+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMFF027L14+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMFF004K21+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMSF050O21+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
JMSF015C10+ TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
                      ____________________________________________________________
consensus TCCCTCAAGAAACGAAGAAAGAAGATGAATTGTTAGACACTTCACAGTTCACGCCCGGAT
 
. : . : . : . : . : . :
JMFF048O09+ TTCAAATTTCCGACGCTGCTT
JMFF021J16+ TTCAAATTTCCGACGCTGCTTCAT
JMFF049I17+ TTCAAATTTCCGACGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
JMFF027L14+ TTCAAATTTCCGAAGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
JMFF004K21+ TTCAAATTTCCGAAGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
JMSF050O21+ TTCAAATTTCCGACGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
JMSF015C10+ TTCAAATTTCCGACGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
                      ____________________________________________________________
consensus TTCAAATTTCCGACGCTGCTTCATACTACGACTGCCGCTATAGAGAATGCATATATACAC
 
. : . : . : . : . : . :
JMFF049I17+ A
JMFF027L14+ A
JMFF004K21+ A
JMSF050O21+ ACACAATATACGTTAGTGTGTGTGAAGATTTTGGTGTGTAGTTTCCGTGTCTGATC
JMSF015C10+ ACACAATATACGTTAGTGTGTGTGAAGATTTTGGTGTGTAGTTTCCGTGTCTGATCTCTC
                      ____________________________________________________________
consensus ACACAATATACGTTAGTGTGTGTGAAGATTTTGGTGTGTAGTTTCCGTGTCTGATCTCTC