Previous Contig 005522:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015C08Sequence490005522 (2)pir|A71425|A714252e-21hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV42_1545394 Arabidopsis tha742013917 (7)gb:BT002983_16365664e-46Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored
JMSF034N09Sequence656005522 (2)pir|A71425|A714252e-24hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV42_1545394 Arabidopsis tha615023642gb:BT002983_16365660.014Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034N09+ CAGCCAAGGGAGAAGCATACATGATGATATTCAATACAATGCACAGATAACCTATA
                      ____________________________________________________________
consensus CAGCCAAGGGAGAAGCATACATGATGATATTCAATACAATGCACAGATAACCTATA
 
. : . : . : . : . : . :
JMSF034N09+ GCATCGATCAAAGCTTCTCCTTCAAGTGTGAACTTGGTCACCAAAATCACAACCGCCAGA
                      ____________________________________________________________
consensus GCATCGATCAAAGCTTCTCCTTCAAGTGTGAACTTGGTCACCAAAATCACAACCGCCAGA
 
. : . : . : . : . : . :
JMSF034N09+ AGAGCAATGTTCAGAGCAGCGGCCAAAGCCGCCGTCTTCTTCTTGGTTTTAGGAGGAGCG
JMSF015C08+ AGGAGGAGCG
                      ____________________________________________________________
consensus AGAGCAATGTTCAGAGCAGCGGCCAAAGCCGCCGTCTTCTTCTTGGTTTTAGGAGGAGCG
 
. : . : . : . : . : . :
JMSF034N09+ AAGACGATGAAGATGAGGACGTATACGGTCTCGGCCAGAACGCCGAAAGCATTGACAGTG
JMSF015C08+ AAGACGATGAAGATGAGGACGTATACGGTCTCGGCCAGAACGCCGAAAGCATTGACAGTG
                      ____________________________________________________________
consensus AAGACGATGAAGATGAGGACGTATACGGTCTCGGCCAGAACGCCGAAAGCATTGACAGTG
 
. : . : . : . : . : . :
JMSF034N09+ AAAACCAGAAAGGCACCGGGTTTTGTAAGGCCATAGTAGCACCAAAGGGACGAACTCAGC
JMSF015C08+ AAAACCAGAAAGGCACCGGGTTTTGTAAGGCCATAGTAGCACCAAAGGGACGAACTCAGC
                      ____________________________________________________________
consensus AAAACCAGAAAGGCACCGGGTTTTGTAAGGCCATAGTAGCACCAAAGGGACGAACTCAGC
 
. : . : . : . : . : . :
JMSF034N09+ AACGTAGAGATGTAAGGAATGCTATCGAAGTCTTCTGTGGATCTGTTCTTCACTATCCTA
JMSF015C08+ AACGTAGAGATGTAAGGAATGCTATCGAAGTCTTCTGTGGATCTGTTCTTCACTATCCTA
                      ____________________________________________________________
consensus AACGTAGAGATGTAAGGAATGCTATCGAAGTCTTCTGTGGATCTGTTCTTCACTATCCTA
 
. : . : . : . : . : . :
JMSF034N09+ ATGAATACATCCCTGCAATAATATAATAATATATATGTCAACACTACAGTGTGTAGTATA
JMSF015C08+ ATGAATACATCCCTGCAATAATATAATAATATATATGTCAACACTACAGTGTGTAGTATA
                      ____________________________________________________________
consensus ATGAATACATCCCTGCAATAATATAATAATATATATGTCAACACTACAGTGTGTAGTATA
 
. : . : . : . : . : . :
JMSF034N09+ TAGATCACATGATTTGAAGTATACTATACATACATCACATATTCAACTCTACCGTACCTG
JMSF015C08+ TAGATCACATGATTTGAAGTATACTATACATACATCACATATTCAACTCTACCGTACCTG
                      ____________________________________________________________
consensus TAGATCACATGATTTGAAGTATACTATACATACATCACATATTCAACTCTACCGTACCTG
 
. : . : . : . : . : . :
JMSF034N09+ GTTTGACCTCTACAATATTAACGATGAGTGGACTTAGAATAGAAATTAACTTACGCGGGG
JMSF015C08+ GTTTGACCTCTACAATATTAACGATGAGTGGACTTAGAATAGAAATTAACTTACGCGGGG
                      ____________________________________________________________
consensus GTTTGACCTCTACAATATTAACGATGAGTGGACTTAGAATAGAAATTAACTTACGCGGGG
 
. : . : . : . : . : . :
JMSF034N09+ GAAAGGAAGATGAAAATGGAGAGGATATTTCCTACAACTCCGACGTAGAAACTCAAGTCT
JMSF015C08+ GAAAGGAAGATGAAAATGGAGAGGATATTTCCTACAACTCCGACGTAGAAACTCAAGTCT
                      ____________________________________________________________
consensus GAAAGGAAGATGAAAATGGAGAGGATATTTCCTACAACTCCGACGTAGAAACTCAAGTCT
 
. : . : . : . : . : . :
JMSF034N09+ AGATCCATTGCTGTATTAGAAAAAACAGAAAGTGAAGCAGCGGAGGGAAGTAGCCACTTC
JMSF015C08+ AGATCCATTGCTGTATTAGAAAAAACAGAAAGTGAAGCAGCGGAGGGAAGTAGCCACTTC
                      ____________________________________________________________
consensus AGATCCATTGCTGTATTAGAAAAAACAGAAAGTGAAGCAGCGGAGGGAAGTAGCCACTTC