Previous Contig 005510:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D21Sequence610005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber610005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFF006P10Sequence606005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber602005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFF008O17Sequence618005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber628005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFF019M01Sequence575005510 (67)pir|T52334|T523348e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber610005510 (67)pir|T52334|T523349e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFF042O20Sequence620005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber419005510 (67)pir|T52334|T523345e-26ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFF049D22Sequence617005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN003L17Sequence601005510 (67)pir|T52334|T523342e-61ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN004I01Sequence551005510 (67)pir|T52334|T523344e-59ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN004N20Sequence640005510 (67)pir|T52334|T523344e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN005M11Sequence530005510 (67)pir|T52334|T523345e-55ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN005O23Sequence578005510 (67)pir|T52334|T523346e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN007J19Sequence500005510 (67)pir|T52334|T523342e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN009B08Sequence585005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN009I08Sequence581005510 (67)pir|T52334|T523342e-64ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN009K03Sequence604005510 (67)pir|T52334|T523344e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN011A01Sequence609005510 (67)pir|T52334|T523349e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN011J05Sequence584005510 (67)pir|T52334|T523343e-64ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN011J14Sequence586005510 (67)pir|T52334|T523347e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN012D05Sequence606005510 (67)pir|T52334|T523345e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN012J21Sequence593005510 (67)pir|T52334|T523342e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN013B11Sequence594005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN014I05Sequence628005510 (67)pir|T52334|T523341e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN014J19Sequence598005510 (67)pir|T52334|T523343e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN015N04Sequence613005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN016J10Sequence612005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN017O16Sequence548005510 (67)pir|T52334|T523342e-58ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN018G15Sequence590005510 (67)pir|T52334|T523346e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN018M09Sequence585005510 (67)pir|T52334|T523347e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN019A14Sequence565005510 (67)pir|T52334|T523342e-61ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN020C24Sequence562005510 (67)pir|T52334|T523345e-61ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN020I23Sequence483005510 (67)pir|T52334|T523343e-39ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN025E24Sequence433005510 (67)gb:AF298826_17841932e-13Prunus avium ubiquitin/ribosomal protein 27a (Ubi) mRNA, complete cds.
JMFN028L13Sequence581005510 (67)pir|T52334|T523347e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN031N15Sequence585005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN032A04Sequence592005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN032B05Sequence610005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN033D14Sequence593005510 (67)pir|T52334|T523345e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN033G01Sequence215005510 (67)pir|S42643|S426436e-33ubiquitin / ribosomal protein S27a - potato (fragment)
JMFN033P21Sequence592005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN033P23Sequence598005510 (67)pir|T52334|T523341e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN034M12Sequence600005510 (67)gb:AF386524_17947202e-62Pyrus communis ubiquitin extension protein (UBI) mRNA, complete cds.
JMFN035B13Sequence582005510 (67)pir|T52334|T523342e-64ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN035D06Sequence585005510 (67)pir|T52334|T523347e-65ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN035J01Sequence586005510 (67)pir|T52334|T523341e-63ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN035K02Sequence596005510 (67)pir|T52334|T523344e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN036O17Sequence613005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN038E22Sequence612005510 (67)pir|T52334|T523341e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN038N02Sequence597005510 (67)pir|T52334|T523344e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN038N19Sequence634005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN041I08Sequence614005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN042G13Sequence597005510 (67)pir|T52334|T523344e-67ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN043I22Sequence534005510 (67)pir|T52334|T523342e-48ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN045P07Sequence623005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN046E08Sequence597005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMFN046O02Sequence615005510 (67)pir|T52334|T523341e-66ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMSF014P02Sequence368005510 (67)gb:DCU68751_16757805e-42Daucus carota ubiquitin-carboxyl extension mRNA, partial cds.618005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMSF022D23Sequence585005510 (67)pir|T52334|T523343e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber527005510 (67)pir|T52334|T523342e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMSF029P24Sequence571005510 (67)pir|T52334|T523345e-56ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber527005510 (67)pir|T52334|T523344e-56ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber
JMSF032H18Sequence708006271 (10)gb:AY084529_15696189e-37Arabidopsis thaliana clone 11084 mRNA, complete sequence.589005510 (67)pir|T52334|T523341e-68ubiquitin extension protein [imported] - potato>gb:STUBIEP_1723166 Solanum tuber

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046O02+ AGCGAAAAAGTAATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN045P07+ GAAAAAGTAATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN041I08+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN036O17+ AAAAAGTAATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN038E22+ AATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN012D05+ AAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN042G13+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN012J21+ GGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN011J14+ TAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN011J05+ CTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN035J01+ TAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN028L13+ ATAACTCAAAACTTAAATAATC-ATAGAT
JMFN043I22- TCTAAAACATAACTCTTAACTTAAATAATC-ATAGAT
JMFN009K03+ AGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN033P23+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN014J19+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN013B11+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN038N02+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN032A04+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN033P21+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN046E08+ CTCAAAACTTAAATAATC-ATAGAT
JMFN033D14+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN035K02+ AAAACATAACTCA-AACTTAAATAATC-ATAGAT
JMFN018G15+ AAAACATAACTCANAACTTAAATAATC-ATAGAT
JMFN018M09+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN035D06+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN035B13+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN020C24+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN017O16+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN005M11+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN038N19+ GAAAAAGTAATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
rJMFF006D21- TAACTCAAAACTTAAATAATC-ATAGAT
JMFF006P10+ CTCAAAACTTAAATAATC-ATAGAT
rJMFF006P10- AAACTTAAATAATC-ATAGAT
JMFN004N20+ AACTCAAAACTTAAATAATC-ATAGAT
JMFN031N15+ CTCAAAACTTAAATAATC-ATAGAT
JMFN005O23+ AACTCAAAACTTAAATAATC-ATAGAT
JMSF029P24+ TAACTCAAAACTTAAATAATC-ATAGAT
JMFN004I01+ AT
JMFN019A14+ ATAATC-ATAGAT
JMFN020I23- AACTCAAAACTTAAATAATC-ATAGAT
JMFF006D21+ TAACTCAAAACTTAAATAATC-ATAGAT
JMFN034M12+ CATAACTCAAAACTTAAATAATC-ATAGAT
JMFN032B05+ ACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN016J10+ AACATAACTCAAAACTTAAATAATC-ATAGAT
JMFF049D22+ AAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN011A01+ CATAACTCAAAACTTTAATAATC-ATAGAT
JMFN014I05+ ATAACTCAAAACTTAAATAATC-ATAGAT
JMFN009B08+ CTCAAAACTTAAATAATC-ATAGAT
JMFN009I08+ AAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFN003L17- AACTCAAAACTTAAATAATC-ATAGAT
rJMFF008O17- GGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
JMFF042O20+ AACTCAAAACTTAAATAATC-ATAGAT
JMFF008O17+ ATAACTCAAAACTTAAATAATCAATAGAT
rJMFF019M01- AACTTAAATAATC-ATAGAT
rJMSF014P02- ACTCAAAACTTAAATAATC-ATAGAT
                      ____________________________________________________________
consensus AGCGAAAAAGTAATAAAGGGTCTAAAACATAACTCAAAACTTAAATAATC-ATAGAT
 
. : . : . : . : . : . :
JMFN046O02+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN045P07+ CCATCACATGACAATGNAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN041I08+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN036O17+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN038E22+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN012D05+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN042G13+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN012J21+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN011J14+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN011J05+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN035J01+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN028L13+ CCATCACATGACAATTGAAATCCATTAAAAACAGCTAAAATTCGATACTCCACCT-GTAA
JMFN043I22- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCCATACTCCAACT-GTAA
JMFN009K03+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN033P23+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN014J19+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN013B11+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN038N02+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN032A04+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN033P21+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN046E08+ CCATCACATGACAATGNAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN033D14+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN035K02+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN018G15+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN018M09+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN035D06+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN035B13+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN020C24+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN017O16+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN005M11+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN038N19+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMFF006D21- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFF006P10+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMFF006P10- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN004N20+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN031N15+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN005O23+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMSF029P24- AATCCATTAAAAAAAACTAAAATTCGATACTCCAACTGGTAA
JMSF029P24+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN004I01+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN019A14+ CCATCACATGACTATTGTAATCCATTATAAAAATCTAAAATTCGATACTCCATCT-GTAA
JMFN015N04+ AACT-GTAA
JMFN020I23- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFF006D21+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN034M12+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN032B05+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN016J10+ CCATCACATGACAATTGAAATCCATTAAAAANAACTAAAATTCGATACTCCAACT-GTAA
JMFF049D22+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN011A01+ CCATCACATGACAATTGAAATCCATTAAAAANAACTAAAATTCGATACTCCAACT-GTAA
JMFN014I05+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN009B08+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN009I08+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMSF022D23+ TGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFN003L17- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMFF008O17- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFF042O20+ CCATCACATGACAATTGAAATCCATTAAAAAAAACT-AAATTCGATACTCCAACT-GTAA
rJMSF022D23- AA
JMFF008O17+ CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMFF019M01- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
JMFF019M01+ GAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMSF032H18- ACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
rJMSF014P02- CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
                      ____________________________________________________________
consensus CCATCACATGACAATTGAAATCCATTAAAAAAAACTAAAATTCGATACTCCAACT-GTAA
 
. : . : . : . : . : . :
JMFN046O02+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN045P07+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN041I08+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN036O17+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN038E22+ TTGTACTAGCAAAAGTAAAGGTTNT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN012D05+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN042G13+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN012J21+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN011J14+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN011J05+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN035J01+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN028L13+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCGCCGCCCTTCTG
JMFN043I22- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAACAGACGCTTAATCACCGCCCTTCTG
JMFN009K03+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN033P23+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN014J19+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN013B11+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN038N02+ TTGTACTAGCAAAAGTAAAGGTTNT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN032A04+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN033P21+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN046E08+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN033D14+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN035K02+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN018G15+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN018M09+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN035D06+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN035B13+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN020C24+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN017O16+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN005M11+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN038N19+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMFF006D21- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF006P10+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMFF006P10- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN004N20+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN031N15+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN005O23+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMSF029P24- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMSF029P24+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN004I01+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN007J19+ GTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN019A14+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCTCCGCCCTTCTG
JMFN015N04+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN020I23- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF006D21+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN034M12+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN032B05+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN016J10+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF049D22+ TTGTACTAGCAAAAGTAAAGGTTTTAAAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN011A01+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN014I05+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN009B08+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN009I08+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMSF022D23+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFN003L17- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMFF008O17- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF042O20+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMSF022D23- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF008O17+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMFF019M01- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
JMFF019M01+ TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMSF032H18- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
rJMSF014P02- TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
                      ____________________________________________________________
consensus TTGTACTAGCAAAAGTAAAGGTTTT-AAAAAGGAAGAGACGCTTAATCACCGCCCTTCTG
 
. : . : . : . : . : . :
JMFN046O02+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN045P07+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN041I08+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN036O17+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN038E22+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN012D05+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN042G13+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN012J21+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN011J14+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN011J05+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN035J01+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN028L13+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN043I22- GAAGACATAGGTGAGACCGCACTTGCCGCAATAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN009K03+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN033P23+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN014J19+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN013B11+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN038N02+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN032A04+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN033P21+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN046E08+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN033D14+ GTAGAAATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN035K02+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN018G15+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN018M09+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN035D06+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN035B13+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN020C24+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN017O16+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN005M11+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN038N19+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMFF006D21- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF006P10+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMFF006P10- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN004N20+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN031N15+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN005O23+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMSF029P24- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMSF029P24+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN004I01+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN007J19+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN019A14+ GTAGACATAGGTGAGACCGCACTTACCGCAGTAGTGCCTGTTTAAGTGGTTAGCCATGAA
JMFN015N04+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMFF042O20- GTAAACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN020I23- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF006D21+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN034M12+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN032B05+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN016J10+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF049D22+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN011A01+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN014I05+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN009B08+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN009I08+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMSF022D23+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFN003L17- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMFF008O17- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF042O20+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMSF022D23- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF008O17+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMFF019M01- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
JMFF019M01+ GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMSF032H18- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
rJMSF014P02- GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
                      ____________________________________________________________
consensus GTAGACATAGGTGAGACCGCACTTGCCGCAGTAGTGCCTGTCGAAGTGGTTAGCCATGAA
 
. : . : . : . : . : . :
JMFN046O02+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN045P07+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN041I08+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN036O17+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN038E22+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN012D05+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN042G13+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN012J21+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN011J14+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN011J05+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN035J01+ GGTACCGGCGCCGCACTCGGCGTTGGGGGACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN028L13+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTATGCACCTTTCCAGA
JMFN043I22- GGTACCGGCGCCGCACTCGGCGATGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN009K03+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN033P23+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN014J19+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCAACTTTCCAGA
JMFN013B11+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN038N02+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN032A04+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN033P21+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN046E08+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN033D14+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN035K02+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN018G15+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN018M09+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN035D06+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN035B13+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN020C24+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN017O16+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN005M11+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN038N19+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMFF006D21- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFF006P10+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMFF006P10- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN004N20+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN031N15+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN005O23+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMSF029P24- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMSF029P24+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN004I01+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN007J19+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGTCTCTGCACCTTTCCAGA
JMFN019A14+ GGTACCGGCGCCGCATTCGGCGTTCGGGCACTCCTTCCTCAGCCTTTGCACCTTTCCAGA
JMFN015N04+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMFF042O20- GGTACCGGCGCCGCACTCGGGGTTGGGGCACTCCTTCCTAAGCCTTTGCACCTTTCCAGA
JMFN020I23- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFF006D21+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN034M12+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGC--CTGCACCTTTTCAGA
JMFN032B05+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN016J10+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFF049D22+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN011A01+ GGTACCGGCGCCGCACTTGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN014I05+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN009B08+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN009I08+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMSF022D23+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFN003L17- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMFF008O17- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFF042O20+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMSF022D23- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMFF008O17+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMFF019M01- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTCCCTCAGCCTCTGCACCTTTCCAGA
JMFF019M01+ GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTCCCTCAGCCTCTGCACCTTTCCAGA
rJMSF032H18- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
rJMSF014P02- GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
JMSF014P02+ TGCACCTTTCCAGA
                      ____________________________________________________________
consensus GGTACCGGCGCCGCACTCGGCGTTGGGGCACTCCTTCCTCAGCCTCTGCACCTTTCCAGA
 
. : . : . : . : . : . :
JMFN046O02+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN045P07+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN041I08+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN036O17+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN038E22+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN012D05+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN042G13+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN012J21+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN011J14+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN011J05+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN035J01+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN028L13+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN043I22- CTCATCCACCTTGTATAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN009K03+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN033P23+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN014J19+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN013B11+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN038N02+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN032A04+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN033P21+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN046E08+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN033D14+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN035K02+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN018G15+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN018M09+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN035D06+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN035B13+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN020C24+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN017O16+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN005M11+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN038N19+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMFF006D21- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFF006P10+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMFF006P10- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN004N20+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN031N15+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN005O23+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMSF029P24- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMSF029P24+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN004I01+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN007J19+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN019A14+ CTCATCCACCTTGTAGAACTGCAAGACGGCCAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN015N04+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMFF042O20- CTCATCCACCTTGTAAAACTGCAAGACGGCGAGCTTGACCTTCTTGGGCTTGGGCTTGAT
JMFN020I23- CTCATCCACCTTGTAAAACTGCAAGACGGCGAGCTTGACCTTCTTGGGCTTGGGCTTGAT
JMFF006D21+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN034M12+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN032B05+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN016J10+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFF049D22+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN011A01+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN014I05+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN009B08+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN009I08+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMSF022D23+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFN003L17- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMFF008O17- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFF042O20+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMSF022D23- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFF008O17+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMFF019M01- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMFF019M01+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMSF032H18- ATCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
rJMSF014P02- CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
JMSF014P02+ CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
                      ____________________________________________________________
consensus CTCATCCACCTTGTAGAACTGCAAGACGGCGAGCTTGACCTTCTTGTGCTTGTGCTTGAT
 
. : . : . : . : . : . :
JMFN046O02+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN045P07+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN041I08+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN036O17+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN038E22+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN012D05+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN042G13+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN012J21+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN011J14+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN011J05+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN035J01+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN028L13+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN043I22- CTTCTTCGGCTTGGTGTAGGGCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAA
JMFN009K03+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN033P23+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN014J19+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN013B11+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN038N02+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN032A04+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN033P21+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN046E08+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN033D14+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN035K02+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN018G15+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN018M09+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN035D06+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN035B13+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN020C24+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN017O16+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN005M11+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN038N19+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMFF006D21- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFF006P10+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMFF006P10- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN004N20+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN031N15+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN005O23+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMSF029P24- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMSF029P24+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN004I01+ CTTCTTCGGCTTGGTGTAGG---TCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN007J19+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN019A14+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN015N04+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMFF042O20- CTTTTTCGGCTTGGGGTAGGTTTTCTTCTTGCGCT
JMFN020I23- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN033G01+ G
JMFN025E24+ GTCTTCTTCTTGGGCTTCTTTGCGCCATCGCGGAGGCGGAG
JMFF006D21+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN034M12+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN032B05+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN016J10+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFF049D22+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN011A01+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN014I05+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN009B08+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN009I08+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMSF022D23+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFN003L17- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMFF008O17- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFF042O20+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMSF022D23- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFF008O17+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMFF019M01- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMFF019M01+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMSF032H18- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
rJMSF014P02- CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
JMSF014P02+ CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
                      ____________________________________________________________
consensus CTTCTTCGGCTTGGTGTAGGTCTTCTTCTTGCGCTTCTTCGCACCACCGCGGAGGCGGAG
 
. : . : . : . : . : . :
JMFN046O02+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN045P07+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN041I08+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN036O17+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN038E22+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN012D05+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN042G13+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN012J21+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN011J14+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN011J05+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN035J01+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN028L13+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN043I22- CACGATGTGGAGGG-TGGACTCCTTCT-GGATGTTGTACTCGGCGAGGGTGCGGC-CGTC
JMFN009K03+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN033P23+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN014J19+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN013B11+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN038N02+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN032A04+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN033P21+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN046E08+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN033D14+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN035K02+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN018G15+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN018M09+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN035D06+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN035B13+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN020C24+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN017O16+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN005M11+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN038N19+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMFF006D21- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFF006P10+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMFF006P10- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN004N20+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN031N15+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN005O23+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMSF029P24- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGG-GAGGGTGCGGC-CGTC
JMSF029P24+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGG-GAGGGTGCGGC-CGTC
JMFN004I01+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN007J19+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN019A14+ CACGAGGTGGAGCG-TGGACTCCTTTT-GAATGTTGTAGTCGGCGAGGGTCCGGC-CGTC
JMFN015N04+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN020I23- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAATCGGCGAGGGTGCGGC-CGTC
JMFN033G01+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN025E24+ CACGAGGTGGAGGGATGAACTCCTTGTAGTAAGGGTTAGTCGGCAAGGGTGCGGCACGTC
JMFF006D21+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN034M12+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN032B05+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN016J10+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFF049D22+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN011A01+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN014I05+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN009B08+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN009I08+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMSF022D23+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFN003L17- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMFF008O17- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFF042O20+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMSF022D23- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFF008O17+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMFF019M01- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMFF019M01+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMSF032H18- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
rJMSF014P02- CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
JMSF014P02+ CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
                      ____________________________________________________________
consensus CACGAGGTGGAGGG-TGGACTCCTTCT-GGATGTTGTAGTCGGCGAGGGTGCGGC-CGTC
 
. : . : . : . : . : . :
JMFN046O02+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN045P07+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN041I08+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN036O17+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN038E22+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN012D05+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN042G13+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN012J21+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN011J14+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN011J05+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN035J01+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN028L13+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN043I22- CTCGAGCTGCTTGACGGCGAAGATGAACCGCTGCTGGGCCGGCGGGATGCCTTCCTTGTG
JMFN009K03+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN033P23+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN014J19+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN013B11+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN038N02+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN032A04+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN033P21+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN046E08+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN033D14+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN035K02+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN018G15+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN018M09+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN035D06+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN035B13+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN020C24+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN017O16+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN005M11+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN038N19+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMFF006D21- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFF006P10+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMFF006P10- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN004N20+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN031N15+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN005O23+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMSF029P24- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMSF029P24+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN004I01+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN007J19+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN019A14+ CTCGAGCTGCTTGCCGGAGAAGATGAGCCGCTGCTGGTCCGCCGGCATGCCTTCCTTGTC
JMFN015N04+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN020I23- C
JMFN033G01+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN025E24+ CTGGAGATGGTTGCCGTCGAAGACGAGCCGTTACTGGTCCGGCGGGAGGCCTTCATGCTC
JMFF006D21+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN034M12+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN032B05+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN016J10+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFF049D22+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN011A01+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN014I05+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN009B08+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN009I08+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMSF022D23+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFN003L17- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMFF008O17- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFF042O20+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMSF022D23- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFF008O17+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMFF019M01- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMFF019M01+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMSF032H18- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
rJMSF014P02- CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
JMSF014P02+ CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
                      ____________________________________________________________
consensus CTCGAGCTGCTTGCCGGCGAAGATGAGCCGCTGCTGGTCCGGCGGGATGCCTTCCTTGTC
 
. : . : . : . : . : . :
JMFN046O02+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN045P07+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN041I08+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN036O17+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN038E22+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN012D05+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN042G13+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN012J21+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN011J14+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN011J05+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN035J01+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN028L13+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN043I22- CTGGATCTTTGCCTTC-ACATTGT
JMFN009K03+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN033P23+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN014J19+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN013B11+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN038N02+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN032A04+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN033P21+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN046E08+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN033D14+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN035K02+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN018G15+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN018M09+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN035D06+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN035B13+ CTGGATCTTTGCCTTC-ACATTGTC-AATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN020C24+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGT
JMFN017O16+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGAT
JMFN005M11+ CTGGATCTTTGCCTTC-ACATTG
JMFN038N19+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMFF006D21- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFF006P10+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMFF006P10- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN004N20+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN031N15+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN005O23+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMSF029P24- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMSF029P24+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN004I01+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN007J19+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN019A14+ CTGCATCTTCGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCTAGGGTGATC
JMFN015N04+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTC
JMFN033G01+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN025E24+ CGGGATCTTTGCCTTCAACATCGTCTGATGGTGTCGGAGGATGCAGCCTCGAGGGAGATG
JMFF006D21+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN034M12+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN032B05+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN016J10+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFF049D22+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN011A01+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN014I05+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN009B08+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN009I08+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMSF022D23+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFN003L17- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMFF008O17- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFF042O20+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMSF022D23- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFF008O17+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMFF019M01- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMFF019M01+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMSF032H18- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
rJMSF014P02- CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
JMSF014P02+ CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
                      ____________________________________________________________
consensus CTGGATCTTTGCCTTC-ACATTGTC-GATGGTGTCCGACGATTCAACCTCGAGGGTGATC
 
. : . : . : . : . : . :
JMFN046O02+ GTCTT-CCCCGTCAGAGTCTTCACAAA
JMFN045P07+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTT
JMFN041I08+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTG
JMFN036O17+ GTCTT-CCCCGTCAGAGTCTTCACAAAGA
JMFN038E22+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCA
JMFN012D05+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCT
JMFN042G13+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCT
JMFN012J21+ GTCTT-CCCCGTCAGAGTCTTCA
JMFN011J14+ GTCTT-CCCCGTCAGAGTCT
JMFN011J05+ GTCTT-CCCCGTCAGAG
JMFN035J01+ GTCTT-CCCCGTCAGAGTC
JMFN028L13+ GTCTT-CCCCGTCAGAGTCTT
JMFN009K03+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCT
JMFN033P23+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTG
JMFN014J19+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTG
JMFN013B11+ GTCTT-CCCCGTCAGAGTCTTCACAAAGA
JMFN038N02+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCT
JMFN032A04+ GTCTT-CCCCGTCAGAGTCTTCACAAA
JMFN033P21+ GTCTT-CCCCGTCAGAGTCTTCACAAA
JMFN046E08+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTG
JMFN033D14+ GTCTT-CCCCGTCAGAGTCTTCACAAAG
JMFN035K02+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCT
JMFN018G15+ GTCTT-CCCCGTCAGAGTCTTCACA
JMFN018M09+ GTCTT-CCCCGTCAGAGTCT
JMFN035D06+ GTCTT-CCCCGTCAGAGTCT
JMFN035B13+ GTCTT-CCCCGTCAGAG
JMFN038N19+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTG
rJMFF006D21- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGT
JMFF006P10+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTG
rJMFF006P10- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTG
JMFN004N20+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTG
JMFN031N15+ GTCTT-CCCCGTCAGAGTCTTCACAAAGA
JMFN005O23+ GTCTT-CCCCGTCAGAGTCT
rJMSF029P24- GTCTT-CCCCG
JMSF029P24+ GTCTT-CCCCG
JMFN004I01+ GTCTT-CCCCGTCAGAGTCT
JMFN007J19+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTG
JMFN019A14+ GTCTT-CCCCGTCA
JMFN033G01+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTT
JMFN025E24+ GTATTGCACCGTCAGAGTCTTCACAAAGA
JMFF006D21+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGT
JMFN034M12+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTG
JMFN032B05+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGT
JMFN016J10+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTG
JMFF049D22+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGG
JMFN011A01+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGT
JMFN014I05+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTG
JMFN009B08+ GTCTT-CCCCGTCAGAGTCTTCACAAAGA
JMFN009I08+ GTCTT-CCCCGTCAGAG
JMSF022D23+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGT
JMFN003L17- G
rJMFF008O17- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGTAAGC
JMFF042O20+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAG
rJMSF022D23- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGT
JMFF008O17+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGTAAGC
rJMFF019M01- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAGCCT
JMFF019M01+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAGCCT
rJMSF032H18- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAG
rJMSF014P02- GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAGCCT
JMSF014P02+ GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAGCCTC
                      ____________________________________________________________
consensus GTCTT-CCCCGTCAGAGTCTTCACAAAGATCTGCATTTTTGCGTTTGTGGTGGAAGCCTC