Previous Contig 005507:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN042D08Sequence644005507 (5)gb:AY084993_15700751e-40Arabidopsis thaliana clone 123862 mRNA, complete sequence.
JMSF014O01Sequence381005507 (5)740005507 (5)gb:AY084993_15700752e-28Arabidopsis thaliana clone 123862 mRNA, complete sequence.
JMSF047O17Sequence672005507 (5)gb:AY084993_15700755e-46Arabidopsis thaliana clone 123862 mRNA, complete sequence.756005507 (5)gb:AY084993_15700751e-53Arabidopsis thaliana clone 123862 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014O01- GGCATTTCTTCTTGAGAAAGAATTGGAAAGAAAATGA
rJMSF047O17- TCTTCTTGAGAAAGAATTGGAAAGAAAATGA
                      ____________________________________________________________
consensus GGCATTTCTTCTTGAGAAAGAATTGGAAAGAAAATGA
 
. : . : . : . : . : . :
rJMSF014O01- GCCTAAATACAAAATAATACTATACTCAGCATACAGG-AGCAGATGAGAGATGTGTGCCA
rJMSF047O17- GCCTAAATACAAAATAATACTATACTCAGCATACAGGCGGCAGATGAGAGATGTGTGCCA
                      ____________________________________________________________
consensus GCCTAAATACAAAATAATACTATACTCAGCATACAGGCGGCAGATGAGAGATGTGTGCCA
 
. : . : . : . : . : . :
rJMSF014O01- TTTAAACATCCAACCATTCATTCATTCTAGCTAGAACAAGTGTGTCCGCAGTAGCTAGCT
rJMSF047O17- TTTAAACATCCAACCATTCATTCATTCTAGCTAGAACAAGTGTGTCCGCAGTAGCTAGCT
                      ____________________________________________________________
consensus TTTAAACATCCAACCATTCATTCATTCTAGCTAGAACAAGTGTGTCCGCAGTAGCTAGCT
 
. : . : . : . : . : . :
rJMSF014O01- TTGACCCATTATTGACAAGCACGCACCAAAATGTCAAACCAGAAGGAAGACACGCCCACC
rJMSF047O17- TTGACCCATTATTGACAAGCACGCACCAAAATGTCAAACCAGAAGGAAGACACGCCCACC
                      ____________________________________________________________
consensus TTGACCCATTATTGACAAGCACGCACCAAAATGTCAAACCAGAAGGAAGACACGCCCACC
 
. : . : . : . : . : . :
rJMSF014O01- ATTGCCAATTACATGAACCTGAAAGACGCAACAGCCTTCTCAACTTCGGCACCATATTTC
rJMSF047O17- ATTGCCAATTACATGAACCTGAAAGACGCAACAGCCTTCTCAACTTCGGCACCATATTTC
                      ____________________________________________________________
consensus ATTGCCAATTACATGAACCTGAAAGACGCAACAGCCTTCTCAACTTCGGCACCATATTTC
 
. : . : . : . : . : . :
rJMSF014O01- TCTGCCTCCTCCTCTACAAACTGTCCAGTAATAGTATACAACCGGTTGTAATAACCGTTG
rJMSF047O17- TCTGCCTCCTCCTCTACAAACTGTCCAGTAATAGTATACAACCGGTTGTAATAACCGTTG
                      ____________________________________________________________
consensus TCTGCCTCCTCCTCTACAAACTGTCCAGTAATAGTATACAACCGGTTGTAATAACCGTTG
 
. : . : . : . : . : . :
rJMSF014O01- TTTGCTATTCCCAGCACTGTGAATAGGCGCCTGAGACTTTGTCCAGGATTTTGGAGTGTG
rJMSF047O17- TTTGCTATTCCCAGCACTGTGAATAGGCGCCTGAGACTTTGTCCAGGATTTTGGAGTGTG
JMFN042D08+ GAATAGGCGCCTGAGACTTTGTCCAGGA-TTTGGAGTGTG
JMSF047O17+ TATTCCCAGCACTGTGAATAGGCGCCTGAGACTTTGTCCAGGATTTTGGAGTGTG
                      ____________________________________________________________
consensus TTTGCTATTCCCAGCACTGTGAATAGGCGCCTGAGACTTTGTCCAGGATTTTGGAGTGTG
 
. : . : . : . : . : . :
rJMSF014O01- TAATC-AATGTAGTACAACCCATTAGCAGATTTGCTATTTATGAGTTTTGCTGCTACTCC
rJMSF047O17- TAATC-AATGTAGTACAACCCATTAGCAGATTTGCTATTTATGAGTTTTGCTGCTACTCC
JMFN042D08+ TAATCNAATGTAGTACAACCCATTAGCAGATNTGCTATTTATGAGTTTTGCTGCTACTCC
JMSF047O17+ TAATC-AATGTAGTACAACCCATTAGCAGATTTGCTATTTATGAGTTTTGCTGCTACTCC
                      ____________________________________________________________
consensus TAATC-AATGTAGTACAACCCATTAGCAGATTTGCTATTTATGAGTTTTGCTGCTACTCC
 
. : . : . : . : . : . :
rJMSF014O01- TGGAGGCCGTTTCCAGCTTCGGTCCAATCCACTAACC
rJMSF047O17- TGGAGGCCGTTTCCAGCTTCGGTCCAATCCACTAACCAGATTCTCTGCAAATTCATCAAC
JMFN042D08+ TGGAGGCCGTTTCCAGCTTCGGTCCAATCCACTAACCAGATTCTCTGCAAATTCATCAAC
JMSF047O17+ TGGAGGCCGTTTCCAGCTTCGGTCCAATCCACTAACCAGATTCTCTGCAAATTCATCAAC
                      ____________________________________________________________
consensus TGGAGGCCGTTTCCAGCTTCGGTCCAATCCACTAACCAGATTCTCTGCAAATTCATCAAC
 
. : . : . : . : . : . :
rJMSF047O17- TTTTCCAAAAGATTCCAATCTGGTGAAGTCAGCACCAAGGCTTGTGATCACTATACTGAC
JMFN042D08+ TTTTCCAAAAGATTCCAATCTGGTGAAGTCAGCACCAAGGCTTGTGATCACTATACTGAC
JMSF047O17+ TTTTCCAAAAGATTCCAATCTGGTGAAGTCAGCACCAAGGCTTGTGATCACTATACTGAC
                      ____________________________________________________________
consensus TTTTCCAAAAGATTCCAATCTGGTGAAGTCAGCACCAAGGCTTGTGATCACTATACTGAC
 
. : . : . : . : . : . :
rJMSF047O17- ATTTGAGTTTGAAGCTTCTTGAGGATAGAAGGCAATCAGTGACCTCACTCCATCACCTTC
JMFN042D08+ ATTTGAGTTTGAAGCTTCTTGAGGATAGAAGGCAATCAGTGACCTCACTCCATCACCTTC
JMSF047O17+ ATTTGAGTTTGAAGCTTCTTGAGGATAGAAGGCAATCAGTGACCTCACTCCATCACCTTC
                      ____________________________________________________________
consensus ATTTGAGTTTGAAGCTTCTTGAGGATAGAAGGCAATCAGTGACCTCACTCCATCACCTTC
 
. : . : . : . : . : . :
rJMSF047O17- TCCAGTTCCCACCTCCCAATCGGCTGGAATGGATATCTTAAACTTGTTCACATCATCAGA
JMFN042D08+ TCCAGTTCCCACCTCCCAATCGGCTGGAATGGATATCTTAAACTTGTTCACATCATCAGA
JMSF047O17+ TCCAGTTCCCACCTCCCAATCGGCTGGAATGGATATCTTAAACTTGTTCACATCATCAGA
                      ____________________________________________________________
consensus TCCAGTTCCCACCTCCCAATCGGCTGGAATGGATATCTTAAACTTGTTCACATCATCAGA
 
. : . : . : . : . : . :
rJMSF047O17- ATAAACACGAGGAGACTCCTTCAC
JMFN042D08+ ATAAACACGAGGAGACTCCTTCACTGCAACATTATCTGCAAATGCAACTGAAGGAAATGC
JMSF047O17+ ATAAACACGAGGAGACTCCTTCAC------ATTATCTGCAAATGCAACTGAAGGAAATGC
JMSF014O01+ AAATGCAACTGAAGGAAATGC
                      ____________________________________________________________
consensus ATAAACACGAGGAGACTCCTTCACTGCAACATTATCTGCAAATGCAACTGAAGGAAATGC
 
. : . : . : . : . : . :
JMFN042D08+ GGAAAGGGAAAATGCAACAAGGCCAGCTTGAAGCAAAAGCTCTCTCCTTTTGCTCAAAGA
JMSF047O17+ GGAAAGGGAAAATGCAACAAGGCCAGCTTGAAGCAAAAGCTCTCTCCTTTTGCTCAAAGA
JMSF014O01+ GGAAAGGGAAAATGCAACAAGGCCAGCTTGAAGCAAAAGCTCTCTCCTTTTGCTCAAAGA
                      ____________________________________________________________
consensus GGAAAGGGAAAATGCAACAAGGCCAGCTTGAAGCAAAAGCTCTCTCCTTTTGCTCAAAGA
 
. : . : . : . : . : . :
JMFN042D08+ TTGCTTTCTGGTATTTCCTTCAGACCCGGGGTTGTTGCAGCAGGAAATATAGGAATTTAC
JMSF047O17+ TTGCTTTCTGGTATTTCCTTCAGACCCGGGGTTGTTGCAGCAGGAAATATAGGAATTTAC
JMSF014O01+ TTGCTTTCTGGTATTTCCTTCAGACCCGGGGTTGTTGCAGCAGGAAATATAGGAATTTAC
                      ____________________________________________________________
consensus TTGCTTTCTGGTATTTCCTTCAGACCCGGGGTTGTTGCAGCAGGAAATATAGGAATTTAC
 
. : . : . : . : . : . :
JMFN042D08+ AGTGTTCTTGAGGCTTTTGGTGTGGAGACGGGTGGCAGAGCGAGAGACGGCAGTGGCAAG
JMSF047O17+ AGTGTTCTTGAGGCTTTTGGTGTGGAGACGGGTGGCAGAGCGAGAGACGGCAGTGGCAAG
JMSF014O01+ AGTGTTCTTGAGGCTTTTGGTGTGGAGACGGGTGGCAGAGCGAGAGACGGCAGTGGCAAG
                      ____________________________________________________________
consensus AGTGTTCTTGAGGCTTTTGGTGTGGAGACGGGTGGCAGAGCGAGAGACGGCAGTGGCAAG
 
. : . : . : . : . : . :
JMFN042D08+ GAAGGATCCACACTGTGAATGCAGCAGAGACGATGAAAGAGAAGAAGTAGCCATTTCCCT
JMSF047O17+ GAAGGATCCACACTGTGAATGCAGCAGAGACGATGAAAGAGAAGAAGTAGCCATTTCCCT
JMSF014O01+ GAAGGATCCACACTGTGAATGCAGCAGAGACGATGAAAGAGAAGAAGTAGCCATTTCCCT
                      ____________________________________________________________
consensus GAAGGATCCACACTGTGAATGCAGCAGAGACGATGAAAGAGAAGAAGTAGCCATTTCCCT
 
. : . : . : . : . : . :
JMFN042D08+ TTTTC
JMSF047O17+ TTTTCTTTTCTTTTCTCTTCTCT
JMSF014O01+ TTTTCTTTTCTTTTCTCTTCTCTAAGCTAAAATTTGTTAACCACTGCTCCATTTTATTCA
                      ____________________________________________________________
consensus TTTTCTTTTCTTTTCTCTTCTCTAAGCTAAAATTTGTTAACCACTGCTCCATTTTATTCA
 
. : . : . : . : . : . :
JMSF014O01+ ATGAATTCCACCTCATTTTCAAAGAACAAAATACAAGTGGATCAGATTTAGGAAAGGCCC
                      ____________________________________________________________
consensus ATGAATTCCACCTCATTTTCAAAGAACAAAATACAAGTGGATCAGATTTAGGAAAGGCCC