Previous Contig 005504:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008K21Sequence266018585125005504 (3)gb:ITU51741_16833080.002Ipomoea trifida receptor protein kinase 2 (IRK2) mRNA, partial cds.
JMSF014N08Sequence436005504 (3)gb:ITU51740_16833074e-19Ipomoea trifida secreted glycoprotein 3 (ISG3) mRNA, complete cds.798011800 (2)gb:ITU20948_16833006e-69Ipomoea trifida receptor protein kinase (IRK1) mRNA, complete cds.
JMSF046K17Sequence740005504 (3)gb:ITU51740_16833079e-56Ipomoea trifida secreted glycoprotein 3 (ISG3) mRNA, complete cds.721011800 (2)gb:AB092809_15251125e-56Lotus corniculatus var. japonicus HAR1 gene for LRR receptor-like kinase, hypoth

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046K17+ TGATCCATAAAAAACCCAATCGTATAATATGAATTGTTCNT
                      ____________________________________________________________
consensus TGATCCATAAAAAACCCAATCGTATAATATGAATTGTTCNT
 
. : . : . : . : . : . :
JMSF046K17+ AAGATTAGGTGTACCAGTAAAGATCTGTCCATTCCATGGCCCATGTCTAAAAGTAATATA
                      ____________________________________________________________
consensus AAGATTAGGTGTACCAGTAAAGATCTGTCCATTCCATGGCCCATGTCTAAAAGTAATATA
 
. : . : . : . : . : . :
JMSF046K17+ TTTATTTACACCCCTGTAAAGAAAAAGTTGAGGGAATCCATCAACATCCAGCATTTCTGT
                      ____________________________________________________________
consensus TTTATTTACACCCCTGTAAAGAAAAAGTTGAGGGAATCCATCAACATCCAGCATTTCTGT
 
. : . : . : . : . : . :
JMSF046K17+ GTATTCACCTAGAGCAGGATCATCATTGCTCTTCCANGATGTCAGGCTCCAGGCGTGACC
                      ____________________________________________________________
consensus GTATTCACCTAGAGCAGGATCATCATTGCTCTTCCANGATGTCAGGCTCCAGGCGTGACC
 
. : . : . : . : . : . :
rJMSF008K21+ AGCTTCATGCCTGGNAGCAAAGTANTACCAGGATAATCAAA
JMSF046K17+ GGNGGCTAGGTTCTNGCCAAGCTTCATGCCTGGTAGCAAAGTATTACCAGGATAATCAAA
                      ____________________________________________________________
consensus GGNGGCTAGGTTCTNGCCAAGCTTCATGCCTGGTAGCAAAGTATTACCAGGATAATCAAA
 
. : . : . : . : . : . :
rJMSF008K21+ GCTNNGCCNGGCGGAATTTTTGGAAGTATGGTAATTTCCCTCTCTCACAACAAGAT
JMSF046K17+ ACTCTGCCAGGCGGAATNTTNGGAANTATGGTCATTTCCCTCTCTCACAATAAGATTTCC
                      ____________________________________________________________
consensus GCTCTGCCAGGCGGAATTTTTGGAAGTATGGTCATTTCCCTCTCTCACAATAAGATTTCC
 
. : . : . : . : . : . :
JMSF046K17+ TGTGTCTGAAAGCTGAGCCACTGGATTTTTCATGGATATTGATGAATTCGATGACCAGAT
                      ____________________________________________________________
consensus TGTGTCTGAAAGCTGAGCCACTGGATTTTTCATGGATATTGATGAATTCGATGACCAGAT
 
. : . : . : . : . : . :
JMSF046K17+ TTCTTCATNGCTACCATCTAGGAGTACTAGGATCCCATTGTCTTTGAGCATTAGCTTGCC
JMSF014N08+ TGAGCATTAGCTTGCC
                      ____________________________________________________________
consensus TTCTTCATNGCTACCATCTAGGAGTACTAGGATCCCATTGTCTTTGAGCATTAGCTTGCC
 
. : . : . : . : . : . :
JMSF046K17+ AAAAGTGTTGTTTAGCGGAGTTTCTCTGTTTGCAACCCAGACCACATCCTTAGTTGGTAT
JMSF014N08+ AAAAGTGTTGTTTAGCGGAGTTTCTCTGTTTGCAACCCAGACCACATCCTTAGTTGGTAT
                      ____________________________________________________________
consensus AAAAGTGTTGTTTAGCGGAGTTTCTCTGTTTGCAACCCAGACCACATCCTTAGTTGGTAT
 
. : . : . : . : . : . :
JMSF046K17+ CTTGCTGTACCAAATGCCAACATATCGATTCTTGGACTTTCCAGGGCTGAAAAATCCAAG
JMSF014N08+ CTTGCTGTACCAAATGCCAACATATCGATTCTTGGACTTTCCAGGGCTGAAAAATCCAAG
                      ____________________________________________________________
consensus CTTGCTGTACCAAATGCCAACATATCGATTCTTGGACTTTCCAGGGCTGAAAAATCCAAG
 
. : . : . : . : . : . :
JMSF046K17+ TTCAAAGTTTCCACCAGCTGAAACTATGGTAGTGCCATCTGTGATGGGATGATCTGTTGT
JMSF014N08+ TTCAAAGTTTCCACCAGCTGAAACTATGGTAGTGCCATCTGTGATGGGATGATCTGTTGT
                      ____________________________________________________________
consensus TTCAAAGTTTCCACCAGCTGAAACTATGGTAGTGCCATCTGTGATGGGATGATCTGTTGT
 
. : . : . : . : . : . :
JMSF046K17+ TATGGTGTCTACTGAGGTGCAAAGTGTGAATAGAGATAGTAAAATGGAGCAAAAGAAATA
JMSF014N08+ TATGGTGTCTACTGAGGTGCAAAGTGTGAATAGAGATAGTAAAATGGAGCAAAAGAAATA
                      ____________________________________________________________
consensus TATGGTGTCTACTGAGGTGCAAAGTGTGAATAGAGATAGTAAAATGGAGCAAAAGAAATA
 
. : . : . : . : . : . :
JMSF046K17+ GAGCCCTTGCCCTTCCATTGANTTCATTTTCTGTTTT
JMSF014N08+ GAGCCCTTGCCCTTCCATTGATTTCATTTTCTGTTTTCCCAGATTTTATGCTTGAAGTTT
                      ____________________________________________________________
consensus GAGCCCTTGCCCTTCCATTGATTTCATTTTCTGTTTTCCCAGATTTTATGCTTGAAGTTT
 
. : . : . : . : . : . :
JMSF014N08+ ATAAATCTTGTACAGGGTAAAAAAGCTAATGATGTTCAGAAATCAGCGACTTTGACAAAA
                      ____________________________________________________________
consensus ATAAATCTTGTACAGGGTAAAAAAGCTAATGATGTTCAGAAATCAGCGACTTTGACAAAA
 
. : . : . : . : . : . :
JMSF014N08+ AGGAAAAGCAAGTGGTCAATGGGCAATGGCACTCTTGTTTCTTGAAAGAAGAGATTCTTC
                      ____________________________________________________________
consensus AGGAAAAGCAAGTGGTCAATGGGCAATGGCACTCTTGTTTCTTGAAAGAAGAGATTCTTC