Previous Contig 005501:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS155A09Sequence581005501 (5)gb:AP004343_18405413e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061
JMSF014M15Sequence218005501 (5)167005501 (5)
JMSF023B06Sequence685019282gb:AK176022_18180101e-80Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.423005501 (5)gb:AP004343_18405413e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061
JMSF051O11Sequence654003950 (7)gb:AK176022_18180105e-76Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-73-C24.754005501 (5)gb:AP004343_18405413e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P061

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051O11+ GATCCAACAGCTCCGATGCATAAGCAGCAATCCATGATTTTAGTAGAT
                      ____________________________________________________________
consensus GATCCAACAGCTCCGATGCATAAGCAGCAATCCATGATTTTAGTAGAT
 
. : . : . : . : . : . :
rJMSF051O11+ ATAAACTCCCCAGGTATAAAGATAAAGCGACCACTGACAGTGTTTGGTTTTGATGATGCA
                      ____________________________________________________________
consensus ATAAACTCCCCAGGTATAAAGATAAAGCGACCACTGACAGTGTTTGGTTTTGATGATGCA
 
. : . : . : . : . : . :
rJMSF051O11+ CCACATGGGCATGCAGAAATAGTGTTTGAGAATGTGTGTGTCTCAGAGAAGAACATTCTT
                      ____________________________________________________________
consensus CCACATGGGCATGCAGAAATAGTGTTTGAGAATGTGTGTGTCTCAGAGAAGAACATTCTT
 
. : . : . : . : . : . :
rJMSF051O11+ CTTGGAGAGGGGCGTGGGTTTGAGATTGCACAGGGTAGGTTGGGTCCTGGAAGGCTGCAT
                      ____________________________________________________________
consensus CTTGGAGAGGGGCGTGGGTTTGAGATTGCACAGGGTAGGTTGGGTCCTGGAAGGCTGCAT
 
. : . : . : . : . : . :
rJMSF051O11+ CATTGCATGAGGTTAATAGGTGCAGCTGAACGTGGTATGCGGATGATGGTTCAGAGGGCT
JMFS155A09- TGCAGCTGAACGTGGTATGCGGATGATGGTTCAGAGGGCT
                      ____________________________________________________________
consensus CATTGCATGAGGTTAATAGGTGCAGCTGAACGTGGTATGCGGATGATGGTTCAGAGGGCT
 
. : . : . : . : . : . :
rJMSF051O11+ AGTGAGAGAAGAGCTTTTGGAAAGTTTATTGCTGAGCATGGTTCATTCCGTTCTGATGTT
rJMSF023B06+ TTCTGATGTT
JMFS155A09- AGTGAGAGAAGAGCTTTTGGAAAGTTTATTGCTGAGCATGGTTCATTCCGTTCTGATGTT
                      ____________________________________________________________
consensus AGTGAGAGAAGAGCTTTTGGAAAGTTTATTGCTGAGCATGGTTCATTCCGTTCTGATGTT
 
. : . : . : . : . : . :
rJMSF051O11+ GCCAGATGCCGAATAGAAGTGGAGAAAACGAGGTTGCTAGTTCTGGAAGCTGCAGACCAG
rJMSF023B06+ GCCAGATGCCGAATAGAAGTGGAGAAAACGNGATTGCTAGTTCTGGAAGCTGCAGACCAG
JMFS155A09- GCCAGATGCCGAATAGAAGTGGAGAAAACGAGATTGCTAGTTCTGGAAGCTGCAGACCAG
                      ____________________________________________________________
consensus GCCAGATGCCGAATAGAAGTGGAGAAAACGAGATTGCTAGTTCTGGAAGCTGCAGACCAG
 
. : . : . : . : . : . :
rJMSF051O11+ CTTGATCGGTTAGGGAACAAAAAGGCTCGTGGTACCATAGCAATGGCAAAGGTAGCAGCT
rJMSF023B06+ CTTGATCGGTTAGGGNACAAAANGGCTCGTGGTACCATAGCAATGGCAAAGGTAGCAGCT
JMFS155A09- CTTGATCGGTTAGGGAACAAAAAGGCTCGTGGTACCATAGCAATGGCAAAGGTAGCAGCT
                      ____________________________________________________________
consensus CTTGATCGGTTAGGGAACAAAAAGGCTCGTGGTACCATAGCAATGGCAAAGGTAGCAGCT
 
. : . : . : . : . : . :
rJMSF051O11+ CCAGATATGGCACTGAAAGTAATTGACATGGCAATGCAAGTGCATGGAGCAGCTGGGTTA
rJMSF023B06+ CCAGATATGGCNCTGAAAGTAATTGACATNNCAATGCAAGTGCATGGAGCAGCTNGGTTN
JMFS155A09- CCAGATATGGCACTGAAAGTAATTGACATGGCAATGCAAGTGCATGGAGCAGCTGGGTTA
                      ____________________________________________________________
consensus CCAGATATGGCACTGAAAGTAATTGACATGGCAATGCAAGTGCATGGAGCAGCTGGGTTA
 
. : . : . : . : . : . :
rJMSF051O11+ TCAGGGGACACTGTTCTAGCACATCTCTGGGCTACAGCCAGGACGTTGAGAATAGCAGAT
rJMSF023B06+ TCAGGGGACACTGTTNTAGCACATCTCTGGGCTACANCCAGGACGTTGAGAANAGCANAT
JMFS155A09- TCAGGGGACACTGTTCTAGCACATCTCTGGGCTACAGCCAGGACGTTGAGAATAGCAGAT
                      ____________________________________________________________
consensus TCAGGGGACACTGTTCTAGCACATCTCTGGGCTACAGCCAGGACGTTGAGAATAGCAGAT
 
. : . : . : . : . : . :
rJMSF051O11+ GGTCCAGATGAAGTGCACTTGGGGACCATTGCAAACTTAGAGTTACGGAGACCCAAACTC
rJMSF023B06+ GGTCCAGATGAAGCGCACTTGGGNACCATCGCAAACTTAGAGTTACGGAGACCCAAACTN
rJMSF014M15+ GGACCATTGCAAACTTAGAGTTACGGAGACCCAAACTC
JMFS155A09- GGTCCAGATGAAGTGCACTTGGGGACCATTGCAAACTTAGAGTTACGGAGACCCAAACTC
JMSF014M15- GGACCATTGCAAACTTAGAGTTACGGAGACCCAAACTC
                      ____________________________________________________________
consensus GGTCCAGATGAAGTGCACTTGGGGACCATTGCAAACTTAGAGTTACGGAGACCCAAACTC
 
. : . : . : . : . : . :
rJMSF051O11+ TGATCATCCTCAATCCTCAATCCTGAAGAAGACACAATCAATAAATAAATAAATAATGTT
rJMSF023B06+ TGATCATCCTCAATCCTCNATCCTGAAGAAGNCACNATCAATAAATAAATAAATAATGTT
rJMSF014M15+ TGATCATCCTCAATCCTCAATCCTGAAGAAGACACAATCAATAAATAAATAAATAATGTT
JMFS155A09- TGATCATCCTCAATCCTCAATCCTGAAGAAGACACAATCAATAAATAAATAAATAATGTT
JMSF014M15- TGATCATCCTCAATCCTCAATCCTGAAGAAGACACAATCAATAAATAAATAAATAATGTT
                      ____________________________________________________________
consensus TGATCATCCTCAATCCTCAATCCTGAAGAAGACACAATCAATAAATAAATAAATAATGTT
 
. : . : . : . : . : . :
rJMSF051O11+ AGTTTCTTTGATTAAGGAAATAAATTTGGATTGCACTTTGTAATT
rJMSF023B06+ AGTTTCTTTGATTAAGGAAATAAATTTGGATTGC
rJMSF014M15+ AGTTTCTTTGATTAAGGAAATAAATTTGGATTGCACTTTGTAATTTGGACATATGATCCG
JMFS155A09- AGTTTCTTTGATTAAGGAAATAAATTTGGATTGCACTTTGTAATTTGGACATATGATCCG
JMSF014M15- AGTTTCTTTGATTAAGGAAATAAATTTGGATTGCACTTTGTAATTTGGACATATGATCCG
                      ____________________________________________________________
consensus AGTTTCTTTGATTAAGGAAATAAATTTGGATTGCACTTTGTAATTTGGACATATGATCCG
 
. : . : . : . : . : . :
rJMSF014M15+ GC
JMFS155A09- GCTGGCGGAGTAATAAGAATTCGAAAAAGAACGA
JMSF014M15- GCTGGCGGAGTAATAAGAATTCGAAAAAGAACGAAATGGTAATAGCTTGCAAAAAAAAAA
                      ____________________________________________________________
consensus GCTGGCGGAGTAATAAGAATTCGAAAAAGAACGAAATGGTAATAGCTTGCAAAAAAAAAA