Previous Contig 005490:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E19Sequence342005490 (5)pir|JC4923|JC49233e-51ribosomal protein L36a.e, cytosolic - upland cotton>gb:GHU64677_1680174 Gossypiu583005490 (5)pir|JC4923|JC49235e-57ribosomal protein L36a.e, cytosolic - upland cotton>gb:GHU64677_1680174 Gossypiu
JMSF014H12Sequence501018886772005490 (5)pir|JC4923|JC49233e-56ribosomal protein L36a.e, cytosolic - upland cotton>gb:GHU64677_1680174 Gossypiu
JMSF014K12Sequence511005490 (5)pir|JC4923|JC49234e-57ribosomal protein L36a.e, cytosolic - upland cotton>gb:GHU64677_1680174 Gossypiu523005490 (5)pir|JC4923|JC49234e-57ribosomal protein L36a.e, cytosolic - upland cotton>gb:GHU64677_1680174 Gossypiu

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014H12+ AACGGGTTTATTAGTTTTCTCCAC
                      ____________________________________________________________
consensus AACGGGTTTATTAGTTTTCTCCAC
 
. : . : . : . : . : . :
rJMSF014H12+ TATTTAGCTAGTGATAATATTTGATGGATATGAAGTGCTGCTATGTTCTTCTACAAGTGC
                      ____________________________________________________________
consensus TATTTAGCTAGTGATAATATTTGATGGATATGAAGTGCTGCTATGTTCTTCTACAAGTGC
 
. : . : . : . : . : . :
rJMSF014H12+ AAGAAACAGAAACTCTACAAGTTCTGCTATTGTTATCTTGAAGACTTAAATTGACCCAGG
                      ____________________________________________________________
consensus AAGAAACAGAAACTCTACAAGTTCTGCTATTGTTATCTTGAAGACTTAAATTGACCCAGG
 
. : . : . : . : . : . :
rJMSF014H12+ GATTGCAAATTCTCCAGTCACAGTAGCACTTTTTCATACTAATATCTGGCCTATTTATTT
                      ____________________________________________________________
consensus GATTGCAAATTCTCCAGTCACAGTAGCACTTTTTCATACTAATATCTGGCCTATTTATTT
 
. : . : . : . : . : . :
rJMSF014H12+ ACCTTCTGTCCCATTTTCTGTTTTGCACTCAGTTATTAGTTGTCTACT---GTACAAAAG
rJMSF014K12+ AGTTTGTGCAGCTCAACTTTGATACAAGTG
rJMFF004E19+ AGTTTGTGCAGCTCAACTTTGATACAAGTG
JMFF004E19- AGTTTGTGCAGCTCAACTTTGATACAAGTG
JMSF014K12- AGTTTGTGCAGCTCAACTTTGATACAAGTG
                      ____________________________________________________________
consensus ACCTTCTGTCCCATTTTCTGTTTTGCACTCAGTTTGTGCAGCTCAACTTTGATACAAGTG
 
. : . : . : . : . : . :
rJMSF014H12+ CCTGAC-CAGTTGCCTGAATCTTACA--GGTGAATGTTCCGAAAACAAAAAAGACATATT
rJMSF014K12+ TTTTTCTCACCTTCAAGTCGGCAAAAATGGTGAATGTTCCGAAAACAAAAAAGACATATT
rJMFF004E19+ TTTTTCTCACCTTCAAGTCGGCAAAAATGGTGAATGTTCCGAAAACAAAAAAGACATATT
JMFF004E19- TTTTTCTCACCTTCAAGTCGGCAAAAATGGTGAATGTTCCGAAAACAAAAAAGACATATT
JMSF014K12- TTTTTCTCACCTTCAAGTCGGCAAAAATGGTGAATGTTCCGAAAACAAAAAAGACATATT
                      ____________________________________________________________
consensus TTTTTCTCACCTTCAAGTCGGCAAAAATGGTGAATGTTCCGAAAACAAAAAAGACATATT
 
. : . : . : . : . : . :
rJMSF014H12+ GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
rJMSF014K12+ GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
rJMFF004E19+ GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
JMFF004E19- GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
JMSF014K12- GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
                      ____________________________________________________________
consensus GCAAATCCAAGGAGTGCAGAAAGCACACATTGCACAAGGTCACCCAATACAAGAAGGGGA
 
. : . : . : . : . : . :
rJMSF014H12+ AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
rJMSF014K12+ AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
rJMFF004E19+ AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
JMFF004E19- AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
JMSF014K12- AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
                      ____________________________________________________________
consensus AAGATAGCCTTGCTGCTCAGGGGAAGCGCCGTTATGATCGCAAACAGTCAGGTTATGGAG
 
. : . : . : . : . : . :
rJMSF014H12+ GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
rJMSF014K12+ GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
rJMFF004E19+ GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
JMFF004E19- GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
JMSF014K12- GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
                      ____________________________________________________________
consensus GACAGACCAAACCTGTATTCCACAAGAAAGCAAAAACAACCAAGAAGATTGTGTTGAGGT
 
. : . : . : . : . : . :
rJMSF014H12+ TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCGATCAAGAGGTGTAAGCATTTTG
rJMSF014K12+ TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCAATTAAGAGGTGTAAGCATTTTG
rJMFF004E19+ TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCGATCAAGAGGTGTAAGCATTTTG
JMFF004E19- TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCGATCAAGAGGTGTAAGCATTTTG
JMSF014K12- TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCAATTAAGAGGTGTAAGCATTTTG
                      ____________________________________________________________
consensus TGCAGTGCCAAGGCTGCAAACATGTTTCACAACATGCGATCAAGAGGTGTAAGCATTTTG
 
. : . : . : . : . : . :
rJMSF014H12+ AGATTGGCGGTGACAAGAAAGGAAAGGG
rJMSF014K12+ AGATTGGCGGTGACAAGAAAGGAAAGGG
rJMFF004E19+ AGATTGGCGGTGACAAGAAAGGAAAGGG
JMFF004E19- AGATTGGCGGTG
JMSF014K12- AGATTGGCGGTGACAAGAAAGGAAAGGGCACATCTCTATTTTAAGATTGACATCAGTGAA
                      ____________________________________________________________
consensus AGATTGGCGGTGACAAGAAAGGAAAGGGCACATCTCTATTTTAAGATTGACATCAGTGAA
 
. : . : . : . : . : . :
JMSF014K12- ATGAAATGGTATCAAATGTTTTCAAGTGTATGCCCACAAAACTATGCTTATTGGCATATT
                      ____________________________________________________________
consensus ATGAAATGGTATCAAATGTTTTCAAGTGTATGCCCACAAAACTATGCTTATTGGCATATT
 
. : . : . : . : . : . :
JMSF014K12- CTCCTGGATTATTTTGAAAAATGCATAGTATATATGTGTTTTGAGGTCTAAATNCTGAGT
                      ____________________________________________________________
consensus CTCCTGGATTATTTTGAAAAATGCATAGTATATATGTGTTTTGAGGTCTAAATNCTGAGT