Previous Contig 005483:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS127E05Sequence570005483 (2)gb:AB025640_15167050.011Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15
JMSF014I04Sequence252005483 (2)801022617pir|D86479|D864792e-16hypothetical protein F14D7.3 - Arabidopsis thaliana>gb:AE005172_892362 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS127E05+ AGGACTTCGTCAATGATACCATTAGCGTGGCAGTCAATCCGATCCACATACAT
                      ____________________________________________________________
consensus AGGACTTCGTCAATGATACCATTAGCGTGGCAGTCAATCCGATCCACATACAT
 
. : . : . : . : . : . :
JMFS127E05+ CTGCCATTTCGATCTTCTCCCTCCATCCATGGAGAACTACTCGTACACCTCGTTCCGGTG
                      ____________________________________________________________
consensus CTGCCATTTCGATCTTCTCCCTCCATCCATGGAGAACTACTCGTACACCTCGTTCCGGTG
 
. : . : . : . : . : . :
JMFS127E05+ AAATCGAGTACGATCGACTCTATAGGGCTTGGCCGAATTGAAGCCGGCTAGGCTGAGGCT
                      ____________________________________________________________
consensus AAATCGAGTACGATCGACTCTATAGGGCTTGGCCGAATTGAAGCCGGCTAGGCTGAGGCT
 
. : . : . : . : . : . :
JMFS127E05+ GTTCATCTTCCCGGCTACTCCTCCTACGGTGATGACGCAGAGCCGGATCGGAGTTTTGGC
                      ____________________________________________________________
consensus GTTCATCTTCCCGGCTACTCCTCCTACGGTGATGACGCAGAGCCGGATCGGAGTTTTGGC
 
. : . : . : . : . : . :
JMFS127E05+ TCTGATGACGTGAAATCTGAGAAGCATAGGTTTGTGGAAGCGTTGAATTCCGGCCCTGTT
                      ____________________________________________________________
consensus TCTGATGACGTGAAATCTGAGAAGCATAGGTTTGTGGAAGCGTTGAATTCCGGCCCTGTT
 
. : . : . : . : . : . :
JMFS127E05+ CAGACAAATCATTCGCCTTCCGCAGCCAGGGAACGCGGATTTTCTGATCTGTTTGGATTA
JMSF014I04+ CTGTTTGGATTA
                      ____________________________________________________________
consensus CAGACAAATCATTCGCCTTCCGCAGCCAGGGAACGCGGATTTTCTGATCTGTTTGGATTA
 
. : . : . : . : . : . :
JMFS127E05+ TATAAAGGAGTGCCGGCGCCGCCTCAAGTGAAGTTGAGGGATCCGGGTATGGAGACGACG
JMSF014I04+ TATAAAGGAGTGCNGGCGCCGCCTCAAGTGAAGTTGAGGGATCCGGGTATGGAGACGACG
                      ____________________________________________________________
consensus TATAAAGGAGTGCCGGCGCCGCCTCAAGTGAAGTTGAGGGATCCGGGTATGGAGACGACG
 
. : . : . : . : . : . :
JMFS127E05+ GTAGTTAAGGAACCGGAGATTCCGGCACCGTGTTTGGATGATAGGATGATCGGATCCAAT
JMSF014I04+ GTAGTTAAGGAACCGGAGATTCCGGCACCGTGTTTGGATGATAGGATGATCGGATCCAAT
                      ____________________________________________________________
consensus GTAGTTAAGGAACCGGAGATTCCGGCACCGTGTTTGGATGATAGGATGATCGGATCCAAT
 
. : . : . : . : . : . :
JMFS127E05+ CCAATCCAATCCAGAAACATATCCAGGATCTGCATCTGGAAGAGCAACAGAATGTATATC
JMSF014I04+ CCAATCCAATCCAGAAACATATCCAGGATCTGCATCTGGAAGAGCAACAGAATGTATATC
                      ____________________________________________________________
consensus CCAATCCAATCCAGAAACATATCCAGGATCTGCATCTGGAAGAGCAACAGAATGTATATC
 
. : . : . : . : . : . :
JMFS127E05+ GCCGGAGCAATACAACAGAATCATACATTTGCCTACA
JMSF014I04+ GCCGGAGCAATACAACAGAATCATACATTTGCCTACACGTTGGCAGGCATCTTGTGTGCC
                      ____________________________________________________________
consensus GCCGGAGCAATACAACAGAATCATACATTTGCCTACACGTTGGCAGGCATCTTGTGTGCC