Previous Contig 005479:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040P05Sequence546005479 (20)gb:AB018242_15139241e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.653005479 (20)gb:AB018242_15139242e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF010G18Sequence391005479 (20)gb:AP003144_18249145e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050641005479 (20)gb:AB018242_15139243e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF010H18Sequence434005479 (20)gb:AP003144_18249148e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050636005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF014H14Sequence481005479 (20)gb:AB018242_15139245e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.642005479 (20)gb:AB018242_15139249e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF019I05Sequence547005479 (20)gb:AB018242_15139247e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.633005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF047E24Sequence546005479 (20)gb:AB018242_15139247e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.639005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF048A19Sequence605005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.570005479 (20)gb:AB018242_15139248e-41Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF048L08Sequence701005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.724005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF049B16Sequence674005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF049E24Sequence597005479 (20)gb:AB018242_15139241e-39Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.562005479 (20)gb:AB018242_15139244e-35Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.
JMSF050C17Sequence693005479 (20)gb:AB018242_15139241e-40Solanum melongena EEF20 mRNA for histone H2A-like protein, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049B16+ TTGAAATGAAAAAGAGTTTCATTAAT
rJMFF040P05- TAAT
                      ____________________________________________________________
consensus TTGAAATGAAAAAGAGTTTCATTAAT
 
. : . : . : . : . : . :
rJMSF048A19- TACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
JMSF049B16+ TGATAACCAAACATTACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
rJMFF040P05- TGATAACCAAACATTACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
rJMSF047E24- CATTACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
rJMSF019I05- GTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
JMSF048A19+ TCTATAAGCAAAG
rJMSF010H18- ACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
JMSF049E24+ CAAAG
rJMSF010G18- TACGTTTACAACACAACTAACAAGTTACACC-TTCTATAAGCAAAG
rJMSF014H14- GTTTACAACACAACTAACAA-TTACACCATTCTATAAGCAAAG
                      ____________________________________________________________
consensus TGATAACCAAACATTACGTTTACAACACAACTAACAA-TTACACC-TTCTATAAGCAAAG
 
. : . : . : . : . : . :
rJMSF048A19- AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
JMSF049B16+ AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
rJMFF040P05- AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
JMFF040P05+ ATCTACAC-TA
rJMSF047E24- AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
rJMSF019I05- AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
rJMSF049E24- AAGGGACAAANACCCCAC-TAATCTACACATA
JMSF048A19+ AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
rJMSF010H18- AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
JMSF049E24+ AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
JMSF019I05+ ATCTACAC-TA
JMSF047E24+ TCTACAC-TA
rJMSF010G18- AATGGCCCCAAGGTCACATACAGAAACAAGGGGACAAA-ACCCCACATAATCTACAC-TA
rJMSF014H14- AATGGCCCCAA-GTCACATACAGAAACAA-GGGANAAA-ACCCCAC-TAATCTACAC-TA
                      ____________________________________________________________
consensus AATGGCCCCAA-GTCACATACAGAAACAA-GGGACAAA-ACCCCAC-TAATCTACAC-TA
 
. : . : . : . : . : . :
rJMSF048A19- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF049B16+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMFF040P05- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMFF040P05+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF047E24- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF019I05- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF049E24- TCANNTCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF048A19+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF010H18- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF049E24+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTNGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF019I05+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF047E24+ TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF010G18- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
rJMSF014H14- TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
JMSF014H14+ T
                      ____________________________________________________________
consensus TCAAATCAAGCAGCCTTCTTCTTGGGGGACTTGGCAGCCTTTGCCTTTGGCTCCTTTGTT
 
. : . : . : . : . : . :
rJMSF048A19- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF049B16+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMFF040P05- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMFF040P05+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF047E24- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF019I05- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF049E24- GCCTCANATCCACTCTTCTTGNGCAACAACACAGGGTTTATGTTGGGCATCACCCCACCA
JMSF048A19+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF010H18- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF049E24+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF019I05+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF047E24+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF010G18- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF010H18+ GGGCAGCACCCCACCA
rJMSF014H14- GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
rJMSF048L08- CTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF048L08+ CTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF050C17+ CTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
JMSF014H14+ GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
                      ____________________________________________________________
consensus GCCTCAGATCCACTCTTCTTGGGCAACAACACAGGGTTTATGTTGGGCAGCACCCCACCA
 
. : . : . : . : . : . :
rJMSF048A19- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF049B16+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMFF040P05- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMFF040P05+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMSF047E24- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMSF019I05- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMSF049E24- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCNCATCGTTCNTCACAGCCAAA
JMSF048A19+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMSF010H18- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF049E24+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCTTCATCGTTCCTCACAGCCAAA
JMSF019I05+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF047E24+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
rJMSF010G18- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF010H18+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF010G18+ TTCCCCAGCTCNTCATCGTTCCTCACAGCCAAA
rJMSF014H14- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAN
rJMSF048L08- TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF048L08+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF050C17+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
JMSF014H14+ TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
                      ____________________________________________________________
consensus TGGGCAATGGTCACCCCAGCCAACAACTTCCCCAGCTCCTCATCGTTCCTCACAGCCAAA
 
. : . : . : . : . : . :
rJMSF048A19- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF049B16+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMFF040P05- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMFF040P05+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF047E24- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF019I05- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF049E24- AGAACATGTNTGGGAATGATCCTGTTCNTCTTGTTGTCCCNCGCTGCATTTCCAGCCAAC
JMSF048A19+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF010H18- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF049E24+ AGAACATGTCTGGGAATGATCCTGTTNTTCTTGTTGTCCCTNGNTGCATTTCCAGCCAAC
JMSF019I05+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF047E24+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF010G18- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF010H18+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF010G18+ AGAACATGTCTGGGAATGATCCTGTTNNTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAN
rJMSF014H14- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
rJMSF048L08- AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF048L08+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF050C17+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
JMSF014H14+ AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
                      ____________________________________________________________
consensus AGAACATGTCTGGGAATGATCCTGTTCTTCTTGTTGTCCCTCGCTGCATTTCCAGCCAAC
 
. : . : . : . : . : . :
rJMSF048A19- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF049B16+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMFF040P05- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMFF040P05+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF047E24- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF019I05- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF049E24- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF048A19+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF010H18- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF049E24+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF019I05+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF047E24+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF010G18- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF010H18+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF010G18+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
rJMSF014H14- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGANCGCCGGTG
rJMSF048L08- TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF048L08+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF050C17+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
JMSF014H14+ TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
                      ____________________________________________________________
consensus TCCAAAACCTCGGCAGCCAGGTATTCGAGAACGGCAGCCATGTAAACAGGAGCGCCGGTG
 
. : . : . : . : . : . :
rJMSF048A19- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF049B16+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMFF040P05- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMFF040P05+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF047E24- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF019I05- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF049E24- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF048A19+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF010H18- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF049E24+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF019I05+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF047E24+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF010G18- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF010H18+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF010G18+ CCGACACGCTGGGCATAGCGGNCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAN
rJMSF014H14- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
rJMSF048L08- CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF048L08+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF050C17+ CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
JMSF014H14+ CCGACACGCTGGGCATAGCGGCCCTTNTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
                      ____________________________________________________________
consensus CCGACACGCTGGGCATAGCGGCCCTTCTTGAGGTAACGCCCGATCCTACCCACCGGGAAC
 
. : . : . : . : . : . :
rJMSF048A19- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF049B16+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMFF040P05- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMFF040P05+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF047E24- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF019I05- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF049E24- TGAAGCCCGGNACGGACGGAGCGGGTAANCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF048A19+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF010H18- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF049E24+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF019I05+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF047E24+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF010G18- TGAAGCCCGGNACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF010H18+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF010G18+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTNTTCGGGCCGCCGCCTTTCCGG
rJMSF014H14- TGAAACCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
rJMSF048L08- TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF048L08+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
JMSF050C17+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTNTTCTTCGGGCCGCCGCCTTTCCGG
JMSF014H14+ TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
                      ____________________________________________________________
consensus TGAAGCCCGGCACGGACGGAGCGGGTAACCGGCTTCTTCTTCGGGCCGCCGCCTTTCCGG
 
. : . : . : . : . : . :
rJMSF048A19- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAA
JMSF049B16+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMFF040P05- CAGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMFF040P05+ CAGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF047E24- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF019I05- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF049E24- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF048A19+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF010H18- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF049E24+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF019I05+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF047E24+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF010G18- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF010H18+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF010G18+ CCGCCGGCACCNTTNTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF014H14- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
rJMSF048L08- CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF048L08+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF050C17+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
JMSF014H14+ CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
                      ____________________________________________________________
consensus CCGCCGGCACCCTTCTTTATCTTCGCCGCCGGAGCATCCATGGAATGATAAGCTAAATTA
 
. : . : . : . : . : . :
JMSF049B16+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGC
rJMFF040P05- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCA
JMFF040P05+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCA
rJMSF047E24- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACC
rJMSF019I05- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACC
rJMSF049E24- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGC
JMSF048A19+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCA
rJMSF010H18- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACCC
JMSF049E24+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACC
JMSF019I05+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACC
JMSF047E24+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACC
rJMSF010G18- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACCC
JMSF010H18+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACCC
JMSF010G18+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACCC
rJMSF014H14- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACGATC
rJMSF048L08- AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACGATC
JMSF048L08+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACGATC
JMSF050C17+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACGA
JMSF014H14+ AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACGATC
                      ____________________________________________________________
consensus AGCTAAACTCTTTGGGTATAAAAAGATTGGAGCGCTTAATGCGGAGGATTGAGCACCATC