Previous Contig 005475:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033J05Sequence523005475 (6)sp|Q9ATF5|RL1X_CASSA2e-6360S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei798004450 (21)sp|P17783|MDHM_CITLA1e-66Malate dehydrogenase, mitochondrial precursor (EC 1.1.1.37).>pir|S10162|DEPUMW m
JMFF033J06Sequence139005475 (6)gb:AY088351_15733714e-17Arabidopsis thaliana clone 5961 mRNA, complete sequence.720004450 (21)gb:AY045592_15611832e-53Arabidopsis thaliana AT3g15020/K15M2_16 mRNA, complete cds.>gb:AY093788_1575440
JMFN011J09Sequence625005475 (6)sp|P51418|RL1X_ARATH2e-9260S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli
JMFN039J16Sequence632005475 (6)sp|P51418|RL1X_ARATH4e-9160S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli
JMSF014G23Sequence243005475 (6)sp|Q9ATF5|RL1X_CASSA2e-1160S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei715005475 (6)sp|P51418|RL1X_ARATH1e-8960S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014G23- GATCAAATAGTAACACAAGAATCTTTACCGACAATGGTCTTGACCTAAA
                      ____________________________________________________________
consensus GATCAAATAGTAACACAAGAATCTTTACCGACAATGGTCTTGACCTAAA
 
. : . : . : . : . : . :
rJMSF014G23- CGAATACTCCAAAATGTGAAACAAAATGATAATTTGGCAGCACAAGACAAAACAAATTAA
JMFN011J09+ AGACAAAACAAATTAA
JMFN039J16+ AGACAAAACAAATTAA
                      ____________________________________________________________
consensus CGAATACTCCAAAATGTGAAACAAAATGATAATTTGGCAGCACAAGACAAAACAAATTAA
 
. : . : . : . : . : . :
rJMSF014G23- ACAAAGAGGTTGGGTCTGGAAGCCTTGTAAGTGGTCTTGAGCTTCCTTGATGGTGGCCTC
JMFN011J09+ ACAAAGAGGTTGGGTCTGGAAGCCTTGTAAGTGGTCTTGAGCTTCCTTGATGGTGGCCTC
JMFN039J16+ ACAAAGAGGTNGGGTCTGGAAGCCTTGTAAGTGGTCTTGAGCTTCCTGNATGGTGGCCTC
                      ____________________________________________________________
consensus ACAAAGAGGTTGGGTCTGGAAGCCTTGTAAGTGGTCTTGAGCTTCCTTGATGGTGGCCTC
 
. : . : . : . : . : . :
rJMSF014G23- ACTTTCTTGAACACCAATGGGAACTTGATCTTTGAGTTATGGAACTGTTTGGTGCTCTCT
JMFN011J09+ ACTTTCTTGAACACCAATGGGAACTTGATCTTTGAGTTATGGAACTGTTTGGTGCTCTCT
JMFN039J16+ ACTTTCTTGAACACCAATGGGAACTTGATCTTTGAGTTATGGAACTGTTTGGTGCTCTCT
                      ____________________________________________________________
consensus ACTTTCTTGAACACCAATGGGAACTTGATCTTTGAGTTATGGAACTGTTTGGTGCTCTCT
 
. : . : . : . : . : . :
rJMSF014G23- CTCTTGCAGAGCTTGGCAGGGACTGTAGCCGTCTTGATGATCTGAATGCAATGATGGCGG
JMFN011J09+ CTCTTGCAGAGCTTGGCAGGGACTGTAGCCGTCTTGATGATCTGAATGCAATGATGGCGG
JMFN039J16+ CTCTTGCAGAGCTTGGCAGGGACTGTAGCCGTCTTGATGATCTGAATGCAATGATGGCGG
JMFF033J05+ GCAGAGCTTGGCAGGGACTGTAGCCGTCTTGATGATCTGAATGCAATGATGGCGG
                      ____________________________________________________________
consensus CTCTTGCAGAGCTTGGCAGGGACTGTAGCCGTCTTGATGATCTGAATGCAATGATGGCGG
 
. : . : . : . : . : . :
rJMSF014G23- ACCCTGTGACGTGAAGCCATCTCAGTGTACATCTGTTCAACAGCACCATTCAAAGTTGTA
JMFN011J09+ ACCCTGTGACGTGAAGCCATCTCAGTGTACATCTGTTCAACAGCACCATTCAAAGTTGTA
JMFN039J16+ ACCCTGTGACGTGAAGCCATCTCAGTGTACATCTGTTCAACAGCACCATTCAAAGTTGTA
JMFF033J05+ ACCCTGTGACGTGAAGCCATCTCAGTGTACATCTGTTCAACAGCACCATTCAAAGTTGTA
                      ____________________________________________________________
consensus ACCCTGTGACGTGAAGCCATCTCAGTGTACATCTGTTCAACAGCACCATTCAAAGTTGTA
 
. : . : . : . : . : . :
rJMSF014G23- TCACGGAACTCCTTGTACATGTTGTGATACCCTGTTCTGCTTTGGTACCTCAGCCATATC
JMFN011J09+ TCACGGAACTCCTTGTACATGTTGTGATACCCTGTTCTGCTTTGGTACCTCAGCCATATC
JMFN039J16+ TCACGGAACTCCTTGTACATGTTGTGATACCCTGTTCTGCTTTGGTACCTCAGCCATATC
JMFF033J06+ CCTCAGCCATATC
JMFF033J05+ TCACGGAACTCCTTGTACATGTTGTGATACCCTGTTCTGCTTTGGTACCTCAGCCATATC
                      ____________________________________________________________
consensus TCACGGAACTCCTTGTACATGTTGTGATACCCTGTTCTGCTTTGGTACCTCAGCCATATC
 
. : . : . : . : . : . :
rJMSF014G23- CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
JMFN011J09+ CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
JMFN039J16+ CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
JMFF033J06+ CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
JMFF033J05+ CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
                      ____________________________________________________________
consensus CCAAAATTCTTGATAGTGGTAGGGTTCTTCTCAAAGATCTCATTGATAGCTAGGACCTGG
 
. : . : . : . : . : . :
rJMSF014G23- CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGG--ACTTCG
JMFN011J09+ CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGG--ACTTCG
JMFN039J16+ CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGG--ACTTCG
JMFF033J06+ CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGG
JMFF033J05+ CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGGTATTTTCG
JMSF014G23+ TTCG
                      ____________________________________________________________
consensus CCATTGGCTTTCTTCACCTTCTTCAGCTTCCTCAAAAAATACCAGAACTTGG--ACTTCG
 
. : . : . : . : . : . :
rJMSF014G23- CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
JMFN011J09+ CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
JMFN039J16+ CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
JMFF033J05+ CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
JMSF014G23+ CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
                      ____________________________________________________________
consensus CACGGACCTCATTAGTGGCCCAAAGCTTCATGCGGTAGATCTTAGGGTGCTCATCGGACT
 
. : . : . : . : . : . :
rJMSF014G23- CCGAGGGGAGAGCTCTTACGACCACTTGGTACTGATGGAA
JMFN011J09+ CCGAGGGGAGAGCTCTTCCGACCACTTGGTACTGATGGAATCTG
JMFN039J16+ CCGAGGGGAGAGCTCTTCCGACCACTTGGTACTGATGGAATCTG
JMFF033J05+ CCGAGGGGAGAGCTCTTCCGACCACTTGGTACTGATGGAATCTG
JMSF014G23+ CCGAGGGGAGAGCTCTTACGACCACTTGGTACTGATGGAA-CTGCAATCACGCAAACAAA
                      ____________________________________________________________
consensus CCGAGGGGAGAGCTCTTCCGACCACTTGGTACTGATGGAATCTGCAATCACGCAAACAAA
 
. : . : . : . : . : . :
JMSF014G23+ ATTCCAAAATTATTTTTCAAAATGAATAGATAATGTGTGTTTGTATATATGCGTACAGAT
                      ____________________________________________________________
consensus ATTCCAAAATTATTTTTCAAAATGAATAGATAATGTGTGTTTGTATATATGCGTACAGAT
 
. : . : . : . : . : . :
JMSF014G23+ TCAATTAACAGAACTAAAAAGAAATTCAAAGCTTATACTCTGAAAATCGCCATTTCTCCA
                      ____________________________________________________________
consensus TCAATTAACAGAACTAAAAAGAAATTCAAAGCTTATACTCTGAAAATCGCCATTTCTCCA